id000085
10.3205/id000085
urn:nbn:de:0183-id0000853
Case Report
Q fever, a rare cause of secondary hemophagocytic lymphohistiocytosis
Nieves Salceda
Nieves Salceda
Juan Francisco
JF
Dr.
Division of Respiratory Medicine, Hospital Universitario Central de Asturias, Avenida de Roma, S/N, 33011 Oviedo, Asturias, SpainDivision of Respiratory Medicine, Hospital Universitario Central de Asturias, Spain
jnsalceda@gmail.com
author
Lozano Cuesta
Lozano Cuesta
Pablo
P
Division of Respiratory Medicine, Hospital Universitario Central de Asturias, Spain
author
Hermoso de Mendoza Aristegui
Hermoso de Mendoza Aristegui
Sara
S
Division of Respiratory Medicine, Hospital Universitario Central de Asturias, Spain
author
Fernández-Suárez
Fernández-Suárez
Jonathan
J
Microbiology Department, Hospital Universitario Central de Asturias, Spain
author
Madrid Carbajal
Madrid Carbajal
Claudia
C
Division of Respiratory Medicine, Hospital Universitario Central de Asturias, Spain
author
García Clemente
García Clemente
Marta María
MM
Division of Respiratory Medicine, Hospital Universitario Central de Asturias, Spain
author
German Medical Science GMS Publishing House
Düsseldorf
610
pneumonia
coxiella
hepatitis
pulmonary medicine
20231206
engl
This is an Open Access article distributed under the terms of the Creative Commons Attribution 4.0 License.
Dieser Artikel ist ein Open-Access-Artikel und steht unter den Lizenzbedingungen der Creative Commons Attribution 4.0 License (Namensnennung).
2195-8831
11
GMS Infectious Diseases
GMS Infect Dis
05
Hemophagocytic lymphohistiocytosis (HLH) is a rare syndrome in which Coxiella burnetii is a very infrequent etiology. We present the case of a 62-year-old male with progressive pulmonary infiltrates, fever, hepatitis, and bicytopenia despite broad spectrum antibiotics. A thorough clinical evaluation led to a high suspicion of Coxiella burnetii infection, subsequently confirmed through a positive serum polymerase chain reaction (PCR) analysis. HLH diagnosis was established based on the fulfillment of 5/8 diagnostic criteria, obviating the need for a bone marrow biopsy. Targeted antibiotic treatment and dexamethasone led to full recovery within two weeks, eliminating the need for stronger immunosuppressive therapy.
IntroductionQ fever is a worldwide zoonotic disease caused by Coxiella burnetii. Infection occurs by inhalation of bacteria from air contaminated by excreta of infected livestock . The disease has an acute phase where nonspecific febrile illness, hepatitis, or pneumonia are most frequent, and a chronic phase, occurring in less than 5% of cases, leading to endocarditis. Hemophagocytic lymphohistiocy<![CDATA[t</PlainText></TextGroup>osis (HLH) is a rare disorder characterized by an aberrant immune response that leads to a sepsis-like syndrome that may rapidly progress to terminal multiple organ failure. HLH can be classified as primary, predominantly affecting pediatric population and associated with genetic factors, or secondary, occurring in the presence of underlying conditions such as infections, malignancies, or autoimmune diseases (Table 1 <ImgLink imgNo="1" imgType="table"/>).</Pgraph></TextBlock>
<TextBlock linked="yes" name="Case description">
<MainHeadline>Case description</MainHeadline><Pgraph>We report the case of a 62-year-old male, smoker of 3<TextGroup><PlainText>4 p</PlainText></TextGroup>acks/year, with a history of rural living and horse ownership and absence of prior disease history. The patient presented with a week-long history of asthenia and high-grade fever up to 40ºC. Clinical examination revealed jaundice and bilateral crackles on lung auscultation. Laboratory testing (Table 2 <ImgLink imgNo="2" imgType="table"/>) demonstrated bicytopenia, elevated acute phase reactants (APR), transaminases, hyperbilirubinemia, and hypertriglyceridemia. Chest radiography revealed bilateral nodular infiltrates, while abdominal ultrasound confirmed hepatomegaly without splenic abnormalities.</Pgraph><Pgraph>Upon admission, a chest-abdomen computed tomography (CT) scan demonstrated bilateral pulmonary infiltrates with a halo sign (Figure 1A <ImgLink imgNo="1" imgType="figure"/>). Blood and sputum cultures, as well as serological tests using indirect immunofluore<TextGroup><PlainText>s</PlainText></TextGroup>cence (Vircel™) for <Mark2>Mycoplasma pneumoniae </Mark2>IgM, <Mark2>Chlamydia pneumoniae </Mark2>IgM, <Mark2>Legionella pneumophila</Mark2>, and <Mark2>Coxiella burnetii </Mark2>IgM/IgG phase II, returned negative results. Despite the initiation of ceftriaxone and levoflox<TextGroup><PlainText>a</PlainText></TextGroup>cin therapy, the patient continued to experience fe<TextGroup><PlainText>ver a</PlainText></TextGroup>nd elevated APR, accompanied by deteriorating bicytopenia (hemoglobin (Hb) 9.4 g/dL, total leukocyte count (TLC) 1005/µL, neutrophils 900/µL, platelets 100,000/µL).</Pgraph><Pgraph>Considering the epidemiological context, symptoms<TextGroup><PlainText>, h</PlainText></TextGroup>epatomegaly, atypical pneumonia, and acute hepatitis, a high clinical suspicion of acute Q fever was raised. The diagnosis was confirmed through a positive serum real-time polymerase chain reaction (PCR) assay developed in-house (see Annex) and a later seroconversion of total IgM and IgG phase II antigens for <Mark2>Coxiella burnetii</Mark2> (Table 2 <ImgLink imgNo="2" imgType="table"/>). Notably, the absence of preceding symptoms or positive IgG phase I antigens rendered chronic Q fever unlikely, and echocardiography ruled out endocarditis.</Pgraph><Pgraph>Peripheral blood flow cytometry (PBFC) was performed due to unexplained bicytopenia, revealing decreased natural killer (NK) cell activity. This finding, along with fever >38.5ºC, bicytopenia, hypertriglyceridemia, and elevated ferritin levels, led to the diagnosis of HLH, fulfilling 5/8 diagnostic criteria determined by the Histiocyte Society updated in 2004 <TextLink reference="2"></TextLink>. Given the concomitant diagnosis of <Mark2>Coxiella burnetii</Mark2> infection, HLH was considered secondary to this pathogen <TextLink reference="3"></TextLink>. </Pgraph><Pgraph>The patient received a two-week course of doxycycline (100 mg/12h) and dexamethasone (60 mg/24h). Clinical improvement was observed, with resolution of fever within five days and a decline in APR levels (Table 2 <ImgLink imgNo="2" imgType="table"/>). Following completion of treatment, the patient was discharged. </Pgraph><Pgraph>At the three-month follow-up, the patient was asymptomatic, with negative PCR and positive IgG phase I/II serologies for <Mark2>Coxiella burnetii</Mark2>. A control CT scan displayed a reduction in pulmonary infiltrates (Figure 1B <ImgLink imgNo="1" imgType="figure"/>).</Pgraph></TextBlock>
<TextBlock linked="yes" name="Discussion">
<MainHeadline>Discussion</MainHeadline><Pgraph>When encountering patients with atypical pneumonia and a history of contact with farm animals or products, including horses <TextLink reference="4"></TextLink>, the possibility of acute Q fever should be considered. Halo sign on CT scans can serve as a valuable diagnostic clue <TextLink reference="5"></TextLink>. PCR testing for <Mark2>Coxiella burnetii</Mark2> shows higher sensitivity <TextLink reference="6"></TextLink> in the early stage of an acute infection compared to serological tests, requiring a 7-to-15-day seroconversion time <TextLink reference="1"></TextLink>.</Pgraph><Pgraph>Doxycycline is the first-line treatment for an acute <Mark2>Coxiella burnetii </Mark2>infection, while fluoroquinolones represent an alternative antibiotic option. However, it is important to note that levofloxacin efficacy, which exhibits intracellular bacteriostatic effects against <Mark2>Coxiella burnetii</Mark2>, may be compromised in the presence of mutations in the quinolone-resistance-determining region <TextLink reference="7"></TextLink>, potentially explaining the lack of initial response to levofloxacin therapy. HLH is an abnormal hyperinflammatory state marked by excessive macrophage and T lymphocyte proliferation, potentially culminating in a fatal cytokine storm. Rising incidence rates, likely attributed to increased clinical awareness and improved diagnostic capabilities, are evidenced by England’s reported incidence of 4 cases per million in 2018, a quadruple rise from 2003 <TextLink reference="8"></TextLink>.</Pgraph><Pgraph>In adults, HLH secondary to infections, autoimmune disorders, and malignancies are predominant. An infrequent primary etiology described is adult onset HLH <TextLink reference="9"></TextLink>. Hypomorphic mutations of known genes involved in familial HLH (PRF1, MUNC13-4, and STXBP2) play a role in the development of late-onset HLH <TextLink reference="10"></TextLink>. In our case, the patient was not tested for HLH gene mutation.</Pgraph><Pgraph>The availability of a flow cytometry lab capable of performing PBFC obviated the need for invasive techniques such as bone marrow biopsy, mitigating potential complications in HLH diagnosis.</Pgraph><Pgraph>Treatment of adult HLH involves the use of immunomodulatory drugs including a combination of cyclosporin A, etoposide, or corticosteroids. Given the non-critical situation and directed antibiotic treatment, corticosteroids alone were used in our patient <TextLink reference="11"></TextLink>. </Pgraph></TextBlock>
<TextBlock linked="yes" name="Conclusion">
<MainHeadline>Conclusion</MainHeadline><Pgraph>HLH represents a life-threatening syndrome with heterogeneous clinical presentations, requiring prompt suspicion and intervention. Secondary HLH in adults often arises from underlying etiologies, demanding a meticulous search of underlying infections and malignancies. Among infectious pathogens <Mark2>Coxiella burnetii</Mark2> infection should be considered, despite being an infrequent cause of this syndrome.</Pgraph></TextBlock>
<TextBlock linked="yes" name="Annex">
<MainHeadline>Annex</MainHeadline><Pgraph>Primers are based in an in-house chromosome fragmen<TextGroup><PlainText>t (</PlainText></TextGroup>114 pb fragment: FQF: gctctcgccgaattcatca; <TextGroup><PlainText>FQR: g</PlainText></TextGroup>acgaagaagaatcgacagcct; FAM PROBE: gt<TextGroup><PlainText>ttcagcttctttatcacg</PlainText></TextGroup>). The target of Coxiella Specific <TextGroup><PlainText>PCR is p</PlainText></TextGroup>rotein DNAa gene.</Pgraph><Pgraph>Results were confirmed with a subsequent PCR for 1<TextGroup><PlainText>6S rRNA</PlainText></TextGroup> gene and sequencing according to Xu et al. <TextLink reference="12"></TextLink>.</Pgraph></TextBlock>
<TextBlock linked="yes" name="Notes">
<MainHeadline>Notes</MainHeadline><SubHeadline>Competing interests</SubHeadline><Pgraph>The authors declare that they have no competing interests.</Pgraph></TextBlock>
<References linked="yes">
<Reference refNo="1">
<RefAuthor>Anderson A</RefAuthor>
<RefAuthor>Bijlmer H</RefAuthor>
<RefAuthor>Fournier PE</RefAuthor>
<RefAuthor>Graves S</RefAuthor>
<RefAuthor>Hartzell J</RefAuthor>
<RefAuthor>Kersh GJ</RefAuthor>
<RefAuthor>Limonard G</RefAuthor>
<RefAuthor>Marrie TJ</RefAuthor>
<RefAuthor>Massung RF</RefAuthor>
<RefAuthor>McQuiston JH</RefAuthor>
<RefAuthor>Nicholson WL</RefAuthor>
<RefAuthor>Paddock CD</RefAuthor>
<RefAuthor>Sexton DJ</RefAuthor>
<RefTitle>Diagnosis and management of Q fever--United States, 2013: recommendations from CDC and the Q Fever Working Group</RefTitle>
<RefYear>2013</RefYear>
<RefJournal>MMWR Recomm Rep</RefJournal>
<RefPage>1-30</RefPage>
<RefTotal>Anderson A, Bijlmer H, Fournier PE, Graves S, Hartzell J, Kersh GJ, Limonard G, Marrie TJ, Massung RF, McQuiston JH, Nicholson WL, Paddock CD, Sexton DJ. Diagnosis and management of Q fever--United States, 2013: recommendations from CDC and the Q Fever Working Group. MMWR Recomm Rep. 2013 Mar;62(RR-03):1-30.</RefTotal>
</Reference>
<Reference refNo="2">
<RefAuthor>Henter JI</RefAuthor>
<RefAuthor>Horne A</RefAuthor>
<RefAuthor>Aricó M</RefAuthor>
<RefAuthor>Egeler RM</RefAuthor>
<RefAuthor>Filipovich AH</RefAuthor>
<RefAuthor>Imashuku S</RefAuthor>
<RefAuthor>Ladisch S</RefAuthor>
<RefAuthor>McClain K</RefAuthor>
<RefAuthor>Webb D</RefAuthor>
<RefAuthor>Winiarski J</RefAuthor>
<RefAuthor>Janka G</RefAuthor>
<RefTitle>HLH-2004: Diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis</RefTitle>
<RefYear>2007</RefYear>
<RefJournal>Pediatr Blood Cancer</RefJournal>
<RefPage>124-31</RefPage>
<RefTotal>Henter JI, Horne A, Aricó M, Egeler RM, Filipovich AH, Imashuku S, Ladisch S, McClain K, Webb D, Winiarski J, Janka G. HLH-2004: Diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis. Pediatr Blood Cancer. 2007 Feb;48(2):124-31. DOI: 10.1002/pbc.21039</RefTotal>
<RefLink>https://doi.org/10.1002/pbc.21039</RefLink>
</Reference>
<Reference refNo="3">
<RefAuthor>Sağlam B</RefAuthor>
<RefAuthor>Albayrak M</RefAuthor>
<RefAuthor>Acar A</RefAuthor>
<RefAuthor>Yıldız A</RefAuthor>
<RefAuthor>Maral S</RefAuthor>
<RefAuthor>Tığlıoğlu M</RefAuthor>
<RefAuthor>Battal İ</RefAuthor>
<RefAuthor>Şahin EN</RefAuthor>
<RefAuthor>Kuş A</RefAuthor>
<RefTitle>Q fever as a rare cause of hemophagocytic lymphohistiocytosis: Case report</RefTitle>
<RefYear>2020</RefYear>
<RefJournal>Transfus Apher Sci</RefJournal>
<RefPage>102747</RefPage>
<RefTotal>Sağlam B, Albayrak M, Acar A, Yıldız A, Maral S, Tığlıoğlu M, Battal İ, Şahin EN, Kuş A. Q fever as a rare cause of hemophagocytic lymphohistiocytosis: Case report. Transfus Apher Sci. 2020 Aug;59(4):102747. DOI: 10.1016/j.transci.2020.102747</RefTotal>
<RefLink>https://doi.org/10.1016/j.transci.2020.102747</RefLink>
</Reference>
<Reference refNo="4">
<RefAuthor>Khademi P</RefAuthor>
<RefAuthor>Ownagh A</RefAuthor>
<RefAuthor>Ataei B</RefAuthor>
<RefAuthor>Kazemnia A</RefAuthor>
<RefAuthor>Eydi J</RefAuthor>
<RefAuthor>Khalili M</RefAuthor>
<RefAuthor>M M</RefAuthor>
<RefAuthor>Mardani K</RefAuthor>
<RefTitle>Molecular detection of Coxiella burnetii in horse sera in Iran</RefTitle>
<RefYear>2020</RefYear>
<RefJournal>Comp Immunol Microbiol Infect Dis</RefJournal>
<RefPage>101521</RefPage>
<RefTotal>Khademi P, Ownagh A, Ataei B, Kazemnia A, Eydi J, Khalili M, M M, Mardani K. Molecular detection of Coxiella burnetii in horse sera in Iran. Comp Immunol Microbiol Infect Dis. 2020 Oct;72:101521. DOI: 10.1016/j.cimid.2020.101521</RefTotal>
<RefLink>https://doi.org/10.1016/j.cimid.2020.101521</RefLink>
</Reference>
<Reference refNo="5">
<RefAuthor>Zhang Y</RefAuthor>
<RefAuthor>Zang GQ</RefAuthor>
<RefAuthor>Tang ZH</RefAuthor>
<RefAuthor>Yu YS</RefAuthor>
<RefTitle>The halo sign of Q fever pneumonia</RefTitle>
<RefYear>2015</RefYear>
<RefJournal>Braz J Infect Dis</RefJournal>
<RefPage>220-1</RefPage>
<RefTotal>Zhang Y, Zang GQ, Tang ZH, Yu YS. The halo sign of Q fever pneumonia. Braz J Infect Dis. 2015;19(2):220-1.
DOI: 10.1016/j.bjid.2014.11.001</RefTotal>
<RefLink>https://doi.org/10.1016/j.bjid.2014.11.001</RefLink>
</Reference>
<Reference refNo="6">
<RefAuthor>Bolaños-Rivero M</RefAuthor>
<RefAuthor>Carranza-Rodríguez C</RefAuthor>
<RefAuthor>Hernández-Cabrera M</RefAuthor>
<RefAuthor>Pisos-Álamo E</RefAuthor>
<RefAuthor>Jaén-Sánchez N</RefAuthor>
<RefAuthor>Pérez-Arellano JL</RefAuthor>
<RefTitle>Utilidad del diagnóstico molecular precoz de fiebre Q y rickettsiosis en pacientes con fiebre de duración intermedia.</RefTitle>
<RefYear>2017</RefYear>
<RefJournal>Enferm Infecc Microbiol Clin</RefJournal>
<RefPage>655-8</RefPage>
<RefTotal>Bolaños-Rivero M, Carranza-Rodríguez C, Hernández-Cabrera M, Pisos-Álamo E, Jaén-Sánchez N, Pérez-Arellano JL. Utilidad del diagnóstico molecular precoz de fiebre Q y rickettsiosis en pacientes con fiebre de duración intermedia. [Usefulness of the early molecular diagnosis of Q fever and rickettsial diseases in patients with fever of intermediate duration]. Enferm Infecc Microbiol Clin. 2017 Dec;35(10):655-8.
DOI: 10.1016/j.eimc.2016.02.026</RefTotal>
<RefLink>https://doi.org/10.1016/j.eimc.2016.02.026</RefLink>
</Reference>
<Reference refNo="7">
<RefAuthor>Vranakis I</RefAuthor>
<RefAuthor>De Bock PJ</RefAuthor>
<RefAuthor>Papadioti A</RefAuthor>
<RefAuthor>Tselentis Y</RefAuthor>
<RefAuthor>Gevaert K</RefAuthor>
<RefAuthor>Tsiotis G</RefAuthor>
<RefAuthor>Psaroulaki A</RefAuthor>
<RefTitle>Identification of potentially involved proteins in levofloxacin resistance mechanisms in Coxiella burnetii</RefTitle>
<RefYear>2011</RefYear>
<RefJournal>J Proteome Res</RefJournal>
<RefPage>756-62</RefPage>
<RefTotal>Vranakis I, De Bock PJ, Papadioti A, Tselentis Y, Gevaert K, Tsiotis G, Psaroulaki A. Identification of potentially involved proteins in levofloxacin resistance mechanisms in Coxiella burnetii.
J Proteome Res. 2011 Feb;10(2):756-62.
DOI: 10.1021/pr100906v</RefTotal>
<RefLink>https://doi.org/10.1021/pr100906v</RefLink>
</Reference>
<Reference refNo="8">
<RefAuthor>West J</RefAuthor>
<RefAuthor>Stilwell P</RefAuthor>
<RefAuthor>Liu H</RefAuthor>
<RefAuthor>Ban L</RefAuthor>
<RefAuthor>Bythell M</RefAuthor>
<RefAuthor>Card TR</RefAuthor>
<RefAuthor>Lanyon P</RefAuthor>
<RefAuthor>Nanduri V</RefAuthor>
<RefAuthor>Rankin J</RefAuthor>
<RefAuthor>Bishton MJ</RefAuthor>
<RefAuthor>Crooks CJ</RefAuthor>
<RefTitle>Temporal Trends in the Incidence of Hemophagocytic Lymphohistiocytosis: A Nationwide Cohort Study From England 2003-2018</RefTitle>
<RefYear>2022</RefYear>
<RefJournal>Hemasphere</RefJournal>
<RefPage>e797</RefPage>
<RefTotal>West J, Stilwell P, Liu H, Ban L, Bythell M, Card TR, Lanyon P, Nanduri V, Rankin J, Bishton MJ, Crooks CJ. Temporal Trends in the Incidence of Hemophagocytic Lymphohistiocytosis: A Nationwide Cohort Study From England 2003-2018. Hemasphere. 2022 Nov;6(11):e797.
DOI: 10.1097/HS9.0000000000000797</RefTotal>
<RefLink>https://doi.org/10.1097/HS9.0000000000000797</RefLink>
</Reference>
<Reference refNo="9">
<RefAuthor>Memon F</RefAuthor>
<RefAuthor>Ahmed J</RefAuthor>
<RefAuthor>Malik F</RefAuthor>
<RefAuthor>Ahmad J</RefAuthor>
<RefAuthor>Memon DA</RefAuthor>
<RefTitle>Adult-onset Primary Hemophagocytic Lymphohistiocytosis: Reporting a Rare Case with Review of Literature</RefTitle>
<RefYear>2020</RefYear>
<RefJournal>Cureus</RefJournal>
<RefPage>e6723</RefPage>
<RefTotal>Memon F, Ahmed J, Malik F, Ahmad J, Memon DA. Adult-onset Primary Hemophagocytic Lymphohistiocytosis: Reporting a Rare Case with Review of Literature. Cureus. 2020 Jan;12(1):e6723. DOI: 10.7759/cureus.6723</RefTotal>
<RefLink>https://doi.org/10.7759/cureus.6723</RefLink>
</Reference>
<Reference refNo="10">
<RefAuthor>Zhang K</RefAuthor>
<RefAuthor>Jordan MB</RefAuthor>
<RefAuthor>Marsh RA</RefAuthor>
<RefAuthor>Johnson JA</RefAuthor>
<RefAuthor>Kissell D</RefAuthor>
<RefAuthor>Meller J</RefAuthor>
<RefAuthor>Villanueva J</RefAuthor>
<RefAuthor>Risma KA</RefAuthor>
<RefAuthor>Wei Q</RefAuthor>
<RefAuthor>Klein PS</RefAuthor>
<RefAuthor>Filipovich AH</RefAuthor>
<RefTitle>Hypomorphic mutations in PRF1, MUNC13-4, and STXBP2 are associated with adult-onset familial HLH</RefTitle>
<RefYear>2011</RefYear>
<RefJournal>Blood</RefJournal>
<RefPage>5794-8</RefPage>
<RefTotal>Zhang K, Jordan MB, Marsh RA, Johnson JA, Kissell D, Meller J, Villanueva J, Risma KA, Wei Q, Klein PS, Filipovich AH. Hypomorphic mutations in PRF1, MUNC13-4, and STXBP2 are associated with adult-onset familial HLH. Blood. 2011 Nov;118(22):5794-8. DOI: 10.1182/blood-2011-07-370148</RefTotal>
<RefLink>https://doi.org/10.1182/blood-2011-07-370148</RefLink>
</Reference>
<Reference refNo="11">
<RefAuthor>La Rosée P</RefAuthor>
<RefAuthor>Horne A</RefAuthor>
<RefAuthor>Hines M</RefAuthor>
<RefAuthor>von Bahr Greenwood T</RefAuthor>
<RefAuthor>Machowicz R</RefAuthor>
<RefAuthor>Berliner N</RefAuthor>
<RefAuthor>Birndt S</RefAuthor>
<RefAuthor>Gil-Herrera J</RefAuthor>
<RefAuthor>Girschikofsky M</RefAuthor>
<RefAuthor>Jordan MB</RefAuthor>
<RefAuthor>Kumar A</RefAuthor>
<RefAuthor>van Laar JAM</RefAuthor>
<RefAuthor>Lachmann G</RefAuthor>
<RefAuthor>Nichols KE</RefAuthor>
<RefAuthor>Ramanan AV</RefAuthor>
<RefAuthor>Wang Y</RefAuthor>
<RefAuthor>Wang Z</RefAuthor>
<RefAuthor>Janka G</RefAuthor>
<RefAuthor>Henter JI</RefAuthor>
<RefTitle>Recommendations for the management of hemophagocytic lymphohistiocytosis in adults</RefTitle>
<RefYear>2019</RefYear>
<RefJournal>Blood</RefJournal>
<RefPage>2465-77</RefPage>
<RefTotal>La Rosée P, Horne A, Hines M, von Bahr Greenwood T, Machowicz R, Berliner N, Birndt S, Gil-Herrera J, Girschikofsky M, Jordan MB, Kumar A, van Laar JAM, Lachmann G, Nichols KE, Ramanan AV, Wang Y, Wang Z, Janka G, Henter JI. Recommendations for the management of hemophagocytic lymphohistiocytosis in adults. Blood. 2019 Jun;133(23):2465-77.
DOI: 10.1182/blood.2018894618</RefTotal>
<RefLink>https://doi.org/10.1182/blood.2018894618</RefLink>
</Reference>
<Reference refNo="12">
<RefAuthor>Xu J</RefAuthor>
<RefAuthor>Millar BC</RefAuthor>
<RefAuthor>Moore JE</RefAuthor>
<RefAuthor>Murphy K</RefAuthor>
<RefAuthor>Webb H</RefAuthor>
<RefAuthor>Fox AJ</RefAuthor>
<RefAuthor>Cafferkey M</RefAuthor>
<RefAuthor>Crowe MJ</RefAuthor>
<RefTitle>Employment of broad-range 16S rRNA PCR to detect aetiological agents of infection from clinical specimens in patients with acute meningitis--rapid separation of 16S rRNA PCR amplicons without the need for cloning</RefTitle>
<RefYear>2003</RefYear>
<RefJournal>J Appl Microbiol</RefJournal>
<RefPage>197-206</RefPage>
<RefTotal>Xu J, Millar BC, Moore JE, Murphy K, Webb H, Fox AJ, Cafferkey M, Crowe MJ. Employment of broad-range 16S rRNA PCR to detect aetiological agents of infection from clinical specimens in patients with acute meningitis--rapid separation of 16S rRNA PCR amplicons without the need for cloning. J Appl Microbiol. 2003;94(2):197-206. DOI: 10.1046/j.1365-2672.2003.01839.x</RefTotal>
<RefLink>https://doi.org/10.1046/j.1365-2672.2003.01839.x</RefLink>
</Reference>
</References>
<Media>
<Tables>
<Table format="png">
<MediaNo>1</MediaNo>
<MediaID>1</MediaID>
<Caption><Pgraph><Mark1>Table 1: Classification and diagnostic criteria of hemophagocytic lymphohistiocytosis</Mark1></Pgraph></Caption>
</Table>
<Table format="png">
<MediaNo>2</MediaNo>
<MediaID>2</MediaID>
<Caption><Pgraph><Mark1>Table 2: Serological and analytical values in patients’ admission and discharge</Mark1></Pgraph></Caption>
</Table>
<NoOfTables>2</NoOfTables>
</Tables>
<Figures>
<Figure format="png" height="366" width="909">
<MediaNo>1</MediaNo>
<MediaID>1</MediaID>
<Caption><Pgraph><Mark1>Figure 1: A: CT scan on patient admission with bilateral pulmonary infiltrates with halo sign; B: CT scan 3 months after discharge with reduction of pulmonary infiltrates</Mark1></Pgraph></Caption>
</Figure>
<NoOfPictures>1</NoOfPictures>
</Figures>
<InlineFigures>
<NoOfPictures>0</NoOfPictures>
</InlineFigures>
<Attachments>
<NoOfAttachments>0</NoOfAttachments>
</Attachments>
</Media>
</OrigData>
</GmsArticle>]]></plaintext></textgroup></pgraph></textblock></origdata></gmsarticle>