<?xml version="1.0" encoding="iso-8859-1" standalone="no"?>
<!DOCTYPE GmsArticle SYSTEM "http://www.egms.de/dtd/2.0.34/GmsArticle.dtd">
<GmsArticle xmlns:xlink="http://www.w3.org/1999/xlink">
  <MetaData>
    <Identifier>id000067</Identifier>
    <IdentifierDoi>10.3205/id000067</IdentifierDoi>
    <IdentifierUrn>urn:nbn:de:0183-id0000675</IdentifierUrn>
    <ArticleType>Case Report</ArticleType>
    <TitleGroup>
      <Title language="en">Wound infection caused by Photobacterium damselae in a 32-year-old woman: case report and review of the literature</Title>
    </TitleGroup>
    <CreatorList>
      <Creator>
        <PersonNames>
          <Lastname>Schr&#246;ttner</Lastname>
          <LastnameHeading>Schr&#246;ttner</LastnameHeading>
          <Firstname>Percy</Firstname>
          <Initials>P</Initials>
          <AcademicTitle>Dr.</AcademicTitle>
        </PersonNames>
        <Address>Institute of Medical Microbiology and Hygiene, Faculty of Medicine, TU Dresden, Fetscherstr. 74, 01307 Dresden, Germany, Phone: &#43;49 351 458-16585, Fax: &#43;49 351 458-6310<Affiliation>Institut f&#252;r Medizinische Mikrobiologie und Hygiene, Medizinische Fakult&#228;t Carl Gustav Carus, Technische Universit&#228;t Dresden, Germany</Affiliation></Address>
        <Email>percy.schroettner&#64;tu-dresden.de</Email>
        <Creatorrole corresponding="yes" presenting="no">author</Creatorrole>
      </Creator>
      <Creator>
        <PersonNames>
          <Lastname>Tille</Lastname>
          <LastnameHeading>Tille</LastnameHeading>
          <Firstname>Eric</Firstname>
          <Initials>E</Initials>
        </PersonNames>
        <Address>
          <Affiliation>Universit&#228;tsCentrum f&#252;r Orthop&#228;die, Unfall- und Plastische Chirurgie (OUPC), Universit&#228;tsklinikum Dresden, Medizinische Fakult&#228;t Carl Gustav Carus Dresden, Germany</Affiliation>
        </Address>
        <Creatorrole corresponding="no" presenting="no">author</Creatorrole>
      </Creator>
      <Creator>
        <PersonNames>
          <Lastname>L&#252;ck</Lastname>
          <LastnameHeading>L&#252;ck</LastnameHeading>
          <Firstname>Christian</Firstname>
          <Initials>C</Initials>
        </PersonNames>
        <Address>
          <Affiliation>Institut f&#252;r Medizinische Mikrobiologie und Hygiene, Medizinische Fakult&#228;t Carl Gustav Carus, Technische Universit&#228;t Dresden, Germany</Affiliation>
        </Address>
        <Creatorrole corresponding="no" presenting="no">author</Creatorrole>
      </Creator>
      <Creator>
        <PersonNames>
          <Lastname>Bunk</Lastname>
          <LastnameHeading>Bunk</LastnameHeading>
          <Firstname>Boyke</Firstname>
          <Initials>B</Initials>
        </PersonNames>
        <Address>
          <Affiliation>Leibniz-Institut DSMZ &#8211; Deutsche Sammlung f&#252;r Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany</Affiliation>
        </Address>
        <Creatorrole corresponding="no" presenting="no">author</Creatorrole>
      </Creator>
    </CreatorList>
    <PublisherList>
      <Publisher>
        <Corporation>
          <Corporatename>German Medical Science GMS Publishing House</Corporatename>
        </Corporation>
        <Address>D&#252;sseldorf</Address>
      </Publisher>
    </PublisherList>
    <SubjectGroup>
      <SubjectheadingDDB>610</SubjectheadingDDB>
      <Keyword language="en">Photobacterium damselae</Keyword>
      <Keyword language="en">wound infection</Keyword>
      <Keyword language="en">whole genome data</Keyword>
      <Keyword language="en">MALDI TOF MS</Keyword>
      <Keyword language="en">antimicrobial profile</Keyword>
    </SubjectGroup>
    <DatePublishedList>
      
    <DatePublished>20201117</DatePublished></DatePublishedList>
    <Language>engl</Language>
    <License license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/4.0/">
      <AltText language="en">This is an Open Access article distributed under the terms of the Creative Commons Attribution 4.0 License.</AltText>
      <AltText language="de">Dieser Artikel ist ein Open-Access-Artikel und steht unter den Lizenzbedingungen der Creative Commons Attribution 4.0 License (Namensnennung).</AltText>
    </License>
    <SourceGroup>
      <Journal>
        <ISSN>2195-8831</ISSN>
        <Volume>8</Volume>
        <JournalTitle>GMS Infectious Diseases</JournalTitle>
        <JournalTitleAbbr>GMS Infect Dis</JournalTitleAbbr>
      </Journal>
    </SourceGroup>
    <ArticleNo>23</ArticleNo>
  </MetaData>
  <OrigData>
    <Abstract language="de" linked="yes"><Pgraph>Wir berichten &#252;ber den Fall einer 32-j&#228;hrigen Frau, die nach einem Badeunfall im Mittelmeer von einer persistierenden Wundinfektion, welche durch <Mark2>Photobacterium</Mark2> <Mark2>damselae</Mark2> verursacht wurde, betroffen war. Neben der Beschreibung des klinischen Falls werden mikrobiologische Charakteristika des Isolats vorgestellt und diskutiert. Diese beinhalten ph&#228;notypische und genotypische Beschreibungen (auch unter Bezugnahme des gesamten bakteriellen Genoms).</Pgraph></Abstract>
    <Abstract language="en" linked="yes"><Pgraph>The case of a 32-year-old woman is reported, who was affected by a persisting wound infection caused by <Mark2>Photobacterium damselae</Mark2> after an accident in the Mediterranean Sea. Besides the clinical case, microbiological characteristics based on the phenotypic and genotypic description of the isolate (including whole genome data) are presented and discussed. </Pgraph></Abstract>
    <TextBlock linked="yes" name="Introduction">
      <MainHeadline>Introduction</MainHeadline><Pgraph><Mark2>Photobacterium damselae</Mark2> belongs to the family of the Vibrionaceae. The species was first described by Love et al. as <Mark2>Vibrio damsela</Mark2> in 1981 <TextLink reference="1"></TextLink>. The first reclassification followed in 1985 and the species was included into the genus Listonella <TextLink reference="2"></TextLink>. In 1991, Smith et al. undertook a reevaluation of the genus Listonella and <Mark2>P. damselae</Mark2> was finally introduced into bacterial taxonomy <TextLink reference="3"></TextLink>. </Pgraph><Pgraph><Mark2>P. damselae</Mark2> has been detected in sea water and is a well-known fish pathogen <TextLink reference="4"></TextLink>, <TextLink reference="5"></TextLink>, <TextLink reference="6"></TextLink>. The two haemoylsins damselysin (Dly) and phobalysin (PhlyP) have been identified as the main virulence factors for fish. The corresponding genes (the <Mark2>dly</Mark2> respectively <Mark2>hlyA</Mark2> gene) are encoded by the virulence plasmid pPHDD1 <TextLink reference="5"></TextLink>. </Pgraph><Pgraph>Besides this, infections in humans, occasionally with a fatal outcome, have also been described. In most of these cases, a previous contact with sea water or fish was reported and infections often originated from minor injuries, which many patients could not remember. Fatal courses of the disease were usually caused by a rapidly progressing necrotizing fasciitis, sepsis or are mediated by bacterial toxins. However, there are also localized infections of the skin, which mostly resulted in a complete healing.</Pgraph><Pgraph>Here we report on a persisting wound infection of a 32-year-old woman, which was caused by <Mark2>P. damselae</Mark2> after an accident in the Mediterranean. Furthermore, we also describe the bacterial isolate both phenotypically and genotypically.</Pgraph></TextBlock>
    <TextBlock linked="yes" name="Case description">
      <MainHeadline>Case description</MainHeadline><Pgraph>In August 2019, a 32-year-old female presented to our emergency department and reported that she had injured herself at a rotor leaf of a boat engine after falling off a dinghy into the salt water of the Mediterranean Sea on a trip to Spain 10 days before. Initially, the patient had received medical treatment by wound cleaning, disinfection and surgical stapling. Unfortunately, there is no information available on an antimicrobial therapy that has already been given in Spain.</Pgraph><Pgraph>Clinically we saw four laceration wounds (each approximately 4&#8211;5 cm) to the lateral thigh and calf of the left leg. While the two proximal wounds (thigh) were inconspicuous, the distal wounds on the calf displayed a local hyperemia, swelling and pressure pain. Additionally, there was slight bleeding and purulent secretion. The peripheral sensitivity, strength and mobility were unaffected. Moreover, the patient showed no systemic signs of infection. Except for a marginal elevation of the inflammation parameter CRP (14.7 mg&#47;L) all further laboratory findings were normal. Radiographic imaging was not altered either. </Pgraph><Pgraph>Apart from a nicotine (20 packyears) and alcohol abuse (2&#8211;3 drinks per day) the medical history of the patient was empty. </Pgraph><Pgraph>The patient was admitted to the hospital and treated surgically. Intraoperatively, the swelling revealed to be an infected hematoma. After collection of microbiological samples, the hematoma was removed and the wound cavity was lavaged thoroughly. A drainage was inserted and the wound was then closed layer by layer. After the surgical treatment the patient received an immediate, empirical, intravenous antibiotic treatment with a cephalosporin (cefuroxime 4x 1.5 g per day). After confirmation of infection by <Mark2>P. damselae</Mark2>, the antibiotic treatment was adjusted to a combination of ampicillin (1 g) and sulbactam (2 g). The antibiotic was administered three times a day. After seven days of intravenous treatment, the patient was discharged from the hospital. We recommended an additional oral antibiotic treatment with amoxicillin (875 mg) and clavulanic acid (125 mg) for seven further days. The antibiotic was administered three times a day. A scheduled appointment for clinical reevaluation was not met by the patient. </Pgraph></TextBlock>
    <TextBlock linked="yes" name="Microbiological methods and results">
      <MainHeadline>Microbiological methods and results</MainHeadline><SubHeadline>Cultivation</SubHeadline><Pgraph>In total, three specimens were sent to the Institute for Medical Microbiology and Hygiene of the Technical University Dresden: the first sample was collected from a wound swab (collected one day prior to the operation, isolate DSM 110633). The second (intraoperative wound swab, isolate DSM 110632) and the third sample (biopsy, isolate DSM 110634) were obtained in the course of the operation. The samples were cultured on Columbia agar with 5&#37; sheep blood (Oxoid, Wesel, Germany), bile chrysoidin glycerol agar (Oxoid, Wesel, Germany), brain heart infusion (Becton Dickinson, Heidelberg, Germany) and Schaedler broth (bioM&#233;rieux, N&#252;rtingen, Germany). The agar plates were incubated for 18 hours at 37&#186;C (without CO<Subscript>2</Subscript> infusion). After incubation, smooth, glossy and slightly transparent bacterial colonies showing a strong beta haemolysis were detected on all Columbia blood agars (Figure 1 <ImgLink imgNo="1" imgType="figure"/>). Bacterial growth was also detected in brain heart infusion (indicated by turbidity) and bile chrysoidin glycerol agar.</Pgraph><SubHeadline>Identification </SubHeadline><Pgraph>MALDI-TOF MS (Bruker Daltonik, Bremen, Germany) was used for primary species identification. All isolates were identified as <Mark2>P. damselae</Mark2> with score values &#62;2.0, which indicates a high confidence identification (DSM 110632: 2.131; DSM 110633: 2.334; DSM 110634: 2.395). The results were additionally confirmed by sequencing of the 16S rRNA gene using 27F (agagtttgatcmtggctcag) as forward and 1498R (cggttaccttgttacgactt) as reverse primer. The data were analysed using the BLAST algorithm (<Hyperlink href="https:&#47;&#47;blast.ncbi.nlm.nih.gov&#47;Blast.cgi">https:&#47;&#47;blast.ncbi.nlm.nih.gov&#47;Blast.cgi</Hyperlink>). The species <TextGroup><Mark2>P. d</Mark2></TextGroup><Mark2>amselae</Mark2> was confirmed in all isolates (99&#37; identity). The PCR product covers a length of 1,378 bases. A total of four mismatches were found.</Pgraph><SubHeadline>Antimicrobial susceptibility testing</SubHeadline><Pgraph>Bacterial colonies originating from the third specimen (DSM 110634, biopsy) were inoculated in physiological sodium chloride solution (Fresenius, Bad Homburg, <TextGroup><PlainText>Germany)</PlainText></TextGroup> and a McFarland standard of 0.5 was created. The bacterial suspension was plated on Mueller-Hinton agar (bioM&#233;rieux, N&#252;rtingen, Germany) using a plate rotator (bestbion dx, K&#246;ln, Germany). Gradient diffusion test strips (bestbion dx, K&#246;ln, Germany) were then placed on the agar plates and incubated at 37&#186;C for 18 hours. The interpretation of the MIC values was performed according to the EUCAST guidelines (PK&#47;PD breakpoints) published in 2020 <TextLink reference="7"></TextLink>. The isolate was susceptible towards <TextGroup><PlainText>ampicillin</PlainText></TextGroup> (0.25 mg&#47;L), ampicillin sulbactam (<TextGroup><PlainText>0.25 mg&#47;L</PlainText></TextGroup>), amo<TextGroup><PlainText>x</PlainText></TextGroup>icillin-clavulanate (0.5 mg&#47;L), piperacillin (<TextGroup><PlainText>0.25 mg&#47;L</PlainText></TextGroup>), piperacillin-tazobactam (<TextGroup><PlainText>0.064 mg&#47;L</PlainText></TextGroup>), cefotaxime (<TextGroup><PlainText>&#8804;0.016 mg&#47;L</PlainText></TextGroup>), ceftazidime (<TextGroup><PlainText>0.125 mg&#47;L</PlainText></TextGroup>), imipenem (<TextGroup><PlainText>0.5 mg&#47;L</PlainText></TextGroup>), meropenem (<TextGroup><PlainText>0.032 mg&#47;L</PlainText></TextGroup>), ciprofloxacin (<TextGroup><PlainText>0.008 mg&#47;L</PlainText></TextGroup>), levofloxacin (<TextGroup><PlainText>0.004 mg&#47;L</PlainText></TextGroup>) and moxifloxacin (<TextGroup><PlainText>0.016 mg&#47;L</PlainText></TextGroup>). However, it showed resistance towards the aminogylcosides gentamicin (1.0 mg&#47;L) and amikacin (4.0 mg&#47;L). There are no breakpoints available for fosfomycin since there is insufficent evidence for its usefulness in the clinical setting. </Pgraph><SubHeadline>Next generation sequencing and whole genome data analysis </SubHeadline><Pgraph>It could be assumed that all the isolates were identical since <Mark2>P. damselae</Mark2> is only extremely rarely detected as a pathogen in humans and beyond that, only pure cultures were found. For this reason, only one isolate (DSM 110634) was chosen for whole genome sequencing. Sequencing of a Nextera XT DNA Library (Nextera XT DNA Library Prep Kit; Illumina, San Diego, CA, USA) was performed on an Illumina NextSeq 550 instrument (Illumina, San Diego, CA, USA) followed by genome assembly using SPAdes 3.14 and an automated annotation applying NCBI Prokarytic Genome Annotation Pipeline <TextLink reference="8"></TextLink>, <TextLink reference="9"></TextLink>. Screening for resistance genes was performed using ResFinder 2.1 as recently described and CARD5 <TextLink reference="10"></TextLink>, <TextLink reference="11"></TextLink>. Pylogenomic analyses were carried out performing digital DNA-DNA hybridization (dDDH). Type (Strain) Genome Server (TYGS) was used as database <TextLink reference="12"></TextLink>. The results showed an identity of 88.2&#37; to <Mark2>P. damselae</Mark2> CIP 102761, thus confirming the species <TextLink reference="13"></TextLink>. Resistance gene analysis using both ResFinder 2.1 and CARD 5 did not lead to an explanation for the observed resistance against aminoglycosides. The genome sequence was submitted to NCBI GenBank under accession number JAATTX000000000.</Pgraph><Pgraph>In total three genes encoding for haemoylsis were detected: <Mark2>dly</Mark2>, <Mark2>hlyA</Mark2> and (chromosomally encoded) <Mark2>hylA</Mark2>. Interestingly, the complete virulence plasmid pPHDD1 was not found.  </Pgraph></TextBlock>
    <TextBlock linked="yes" name="Discussion">
      <MainHeadline>Discussion</MainHeadline><Pgraph>To the best of our knowledge, a total of 29 case descriptions of <Mark2>P. damselae</Mark2> infections in humans (including the present report) are described so far (Table 1 <ImgLink imgNo="1" imgType="table"/>). All reports (except one) have in common that an infection has always been preceded by contact with sea water (the natural reservoir of <Mark2>P. damselae</Mark2>), fish or other sea animals (see Table 1 <ImgLink imgNo="1" imgType="table"/>) <TextLink reference="14"></TextLink>. Additionally, a closer look at the available literature reveals that fatal cases tend to affect (but are not exclusive to) older patients (n&#61;10; average age&#61;<TextGroup><PlainText>63.1 years</PlainText></TextGroup>). In contrast, there are young patients who have recovered from the infection (n&#61;19; average age&#61;38.9 years) (Table 1 <ImgLink imgNo="1" imgType="table"/>). The patient in the present case was 32 years old. Based on our current knowledge, the course of the disease was also positive, which is congruent with the observations mentioned before. </Pgraph><Pgraph>Basically, there are two possible explanations for a worse course of the infection. On the one hand, the deteriorating function of the immune system with age (immunosenescence) should be mentioned <TextLink reference="15"></TextLink>. On the other hand, the different virulence properties of the strains must be taken into account. So far, the two haemolysins damselysin (Dly) and phobalysin (PhlyP) have been described as the most important virulence factors <TextLink reference="5"></TextLink>. Our isolates also showed strong &#946;-haemolysis. Genome analysis of the entire genome of the <Mark2>P. damselae</Mark2> strain DSM 110634 showed both haemolysins being present with 100&#37; amino acid identity (Swissprot IDs D1J6Q4 and D1J6Q5). Both genes were found in one cluster similar to their assembly in pPHDD1. Moreover, the corresponding assembled contig, namely NODE&#95;21, carried the <Mark2>parA</Mark2> replication gene showing clearly both haemolysin genes are encoded on a plasmid. However, the complete plasmid pPHDD1 (RefSeq ID NC&#95;014653) was not found as such. Obviously, the virulence plasmid structure differs within our isolate. Surprisingly, a second chromosomally encoded haemolysin gene was found with 92&#37; amino acid identity to <Mark2>hlyA</Mark2> (NODE&#95;13:122725.120917). </Pgraph><Pgraph>We were also able to reliably identify our isolate using the MALDI TOF MS since it was in accordance to results obtained from sequencing of the 16S rRNA gene and the dDDH. However, a general statement about the suitability of MALDI TOF MS for the identification of <Mark2>P. damselae</Mark2> can only be made using a larger collection of well-characterized strains derived from clinical specimens.</Pgraph><Pgraph>The data currently available are insufficient to make general statements about the antimicrobial resistance of <Mark2>P. damselae</Mark2>. However, previous reports suggest that the species is sensitive to most antibiotics (including most of the &#946;-lactams, cotrimoxazole, aminoglycosides, fluoroquinolones) <TextLink reference="16"></TextLink>. However, resistance to aminogly<TextGroup><PlainText>c</PlainText></TextGroup>osides (as in the present case report) has also been described <TextLink reference="17"></TextLink>. Unfortunately, a search for genes providing aminoglycoside resistance using both ResFinder 2.1 and CARD 5 did not obtain any results. There are basically three possible explanations for the development of resistance to aminoglycosides: </Pgraph><Pgraph><OrderedList><ListItem level="1" levelPosition="1" numString="1.">reduction of the concentration of aminoglycosides within the bacterial cell (e.g. efflux pump), </ListItem><ListItem level="1" levelPosition="2" numString="2.">changes in the target structure for aminoglycosides (e.g. 16S methylation or ribosomal mutations) and </ListItem><ListItem level="1" levelPosition="3" numString="3.">enzymatic inactivation (e.g. aminoglycoside acetyltransferases, aminoglycoside nucleotidyltranserases, aminoglycoside phosphotransferases) <TextLink reference="18"></TextLink>. </ListItem></OrderedList></Pgraph><Pgraph>It is important to note that amikacin is not inactivated by enzymes, which act on gentamycin or tobramycin <TextLink reference="18"></TextLink>. However, both gentamycin and amikacin are resistant in our case. For this reason, a resistance mechanism is suggested in our isolate, which affects the entire class of aminoglycosides (e.g. an efflux pump). </Pgraph></TextBlock>
    <TextBlock linked="yes" name="Conclusion">
      <MainHeadline>Conclusion</MainHeadline><Pgraph>We describe the 29<Superscript>th</Superscript> case of a human infection caused by the marine bacterium <Mark2>P. damselae</Mark2>. Infections affecting younger patients (like the patient described here) seem to show a more favorable course of healing than those affecting older patients. Since the patient in this report did not keep a follow-up visit at the hospital after the therapy, we assume the healing process has been uncomplicated. Using whole genome sequencing, we could detect three haemolysins serving as virulence factors. However, the issue whether those proteins really contribute to human infections as well needs to be elucidated in more detail in further studies. Moreover, a larger strain collection is needed to be able to create a reliable resistance profile. </Pgraph></TextBlock>
    <TextBlock linked="yes" name="Notes">
      <MainHeadline>Notes</MainHeadline><SubHeadline>Competing interests</SubHeadline><Pgraph>The authors declare that they have no competing interests.</Pgraph><SubHeadline>Acknowledgements</SubHeadline><Pgraph>The authors thank Franziska Klann and Stefan Tiede for excellent technical assistance and Thomas Riedel for support regarding strain deposition.</Pgraph></TextBlock>
    <References linked="yes">
      <Reference refNo="1">
        <RefAuthor>Love M</RefAuthor>
        <RefAuthor>Teebken-Fisher D</RefAuthor>
        <RefAuthor>Hose JE</RefAuthor>
        <RefAuthor>Farmer JJ 3rd</RefAuthor>
        <RefAuthor>Hickman FW</RefAuthor>
        <RefAuthor>Fanning GR</RefAuthor>
        <RefTitle>Vibrio damsela, a Marine Bacterium, Causes Skin Ulcers on the Damselfish Chromis punctipinnis</RefTitle>
        <RefYear>1981</RefYear>
        <RefJournal>Science</RefJournal>
        <RefPage>1139-40</RefPage>
        <RefTotal>Love M, Teebken-Fisher D, Hose JE, Farmer JJ 3rd, Hickman FW, Fanning GR. Vibrio damsela, a Marine Bacterium, Causes Skin Ulcers on the Damselfish Chromis punctipinnis. Science. 1981 Dec;214(4525):1139-40. DOI: 10.1126&#47;science.214.4525.1139</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1126&#47;science.214.4525.1139</RefLink>
      </Reference>
      <Reference refNo="2">
        <RefAuthor>MacDonell MT</RefAuthor>
        <RefAuthor>Colwell RR</RefAuthor>
        <RefTitle>Phylogeny of the Vibrionaceae, and Recommendation for Two New Genera, Listonella and Shewanella</RefTitle>
        <RefYear>1985</RefYear>
        <RefJournal>Syst Appl Microbiol</RefJournal>
        <RefPage>171-82</RefPage>
        <RefTotal>MacDonell MT, Colwell RR. Phylogeny of the Vibrionaceae, and Recommendation for Two New Genera, Listonella and Shewanella. Syst Appl Microbiol. 1985;6(2):171-82. DOI: 10.1016&#47;S0723-2020(85)80051-5</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1016&#47;S0723-2020(85)80051-5</RefLink>
      </Reference>
      <Reference refNo="3">
        <RefAuthor>Smith SK</RefAuthor>
        <RefAuthor>Sutton DC</RefAuthor>
        <RefAuthor>Fuerst JA</RefAuthor>
        <RefAuthor>Reichelt JL</RefAuthor>
        <RefTitle>Evaluation of the genus Listonella and reassignment of Listonella damsela (Love et al.) MacDonell and Colwell to the genus Photobacterium as Photobacterium damsela comb. nov. with an emended description</RefTitle>
        <RefYear>1991</RefYear>
        <RefJournal>Int J Syst Bacteriol</RefJournal>
        <RefPage>529-34</RefPage>
        <RefTotal>Smith SK, Sutton DC, Fuerst JA, Reichelt JL. Evaluation of the genus Listonella and reassignment of Listonella damsela (Love et al.) MacDonell and Colwell to the genus Photobacterium as Photobacterium damsela comb. nov. with an emended description. Int J Syst Bacteriol. 1991 Oct;41(4):529-34. DOI: 10.1099&#47;00207713-41-4-529</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1099&#47;00207713-41-4-529</RefLink>
      </Reference>
      <Reference refNo="4">
        <RefAuthor>Fouz B</RefAuthor>
        <RefAuthor>Toranzo AE</RefAuthor>
        <RefAuthor>Mil&#225;n M</RefAuthor>
        <RefAuthor>Amaro C</RefAuthor>
        <RefTitle>Evidence that water transmits the disease caused by the fish pathogen Photobacterium damselae subsp. damselae</RefTitle>
        <RefYear>2000</RefYear>
        <RefJournal>J Appl Microbiol</RefJournal>
        <RefPage>531-5</RefPage>
        <RefTotal>Fouz B, Toranzo AE, Mil&#225;n M, Amaro C. Evidence that water transmits the disease caused by the fish pathogen Photobacterium damselae subsp. damselae.  J Appl Microbiol. 2000 Mar;88(3):531-5. DOI: 10.1046&#47;j.1365-2672.2000.00992.x</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1046&#47;j.1365-2672.2000.00992.x</RefLink>
      </Reference>
      <Reference refNo="5">
        <RefAuthor>Terceti MS</RefAuthor>
        <RefAuthor>Ogut H</RefAuthor>
        <RefAuthor>Osorio CR</RefAuthor>
        <RefTitle>Photobacterium damselae subsp. damselae, an Emerging Fish Pathogen in the Black Sea: Evidence of a Multiclonal Origin</RefTitle>
        <RefYear>2016</RefYear>
        <RefJournal>Appl Environ Microbiol</RefJournal>
        <RefPage>3736-45</RefPage>
        <RefTotal>Terceti MS, Ogut H, Osorio CR. Photobacterium damselae subsp. damselae, an Emerging Fish Pathogen in the Black Sea: Evidence of a Multiclonal Origin. Appl Environ Microbiol. 2016 Jul;82(13):3736-45. DOI: 10.1128&#47;AEM.00781-16</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1128&#47;AEM.00781-16</RefLink>
      </Reference>
      <Reference refNo="6">
        <RefAuthor>Andreoni F</RefAuthor>
        <RefAuthor>Magnani M</RefAuthor>
        <RefTitle>Photobacteriosis: prevention and diagnosis</RefTitle>
        <RefYear>2014</RefYear>
        <RefJournal>J Immunol Res</RefJournal>
        <RefPage>793817</RefPage>
        <RefTotal>Andreoni F, Magnani M. Photobacteriosis: prevention and diagnosis. J Immunol Res. 2014;2014:793817. DOI: 10.1155&#47;2014&#47;793817</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1155&#47;2014&#47;793817</RefLink>
      </Reference>
      <Reference refNo="7">
        <RefAuthor>European Committee on Antimicrobial Susceptibility (EUCAST)</RefAuthor>
        <RefTitle></RefTitle>
        <RefYear>2020</RefYear>
        <RefBookTitle>Breakpoint tables for interpretation of MICs and zone diameters</RefBookTitle>
        <RefPage></RefPage>
        <RefTotal>European Committee on Antimicrobial Susceptibility (EUCAST). Breakpoint tables for interpretation of MICs and zone diameters. Version 10.0. 2020. Available from: https:&#47;&#47;www.eucast.org&#47;clinical&#95;breakpoints&#47;</RefTotal>
        <RefLink>https:&#47;&#47;www.eucast.org&#47;clinical&#95;breakpoints&#47;</RefLink>
      </Reference>
      <Reference refNo="8">
        <RefAuthor>Zerbino DR</RefAuthor>
        <RefAuthor>Birney E</RefAuthor>
        <RefTitle>Velvet: algorithms for de novo short read assembly using de Bruijn graphs</RefTitle>
        <RefYear>2008</RefYear>
        <RefJournal>Genome Res</RefJournal>
        <RefPage>821-9</RefPage>
        <RefTotal>Zerbino DR, Birney E. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 2008 May;18(5):821-9. DOI: 10.1101&#47;gr.074492.107</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1101&#47;gr.074492.107</RefLink>
      </Reference>
      <Reference refNo="9">
        <RefAuthor>Seemann T</RefAuthor>
        <RefTitle>Prokka: rapid prokaryotic genome annotation</RefTitle>
        <RefYear>2014</RefYear>
        <RefJournal>Bioinformatics</RefJournal>
        <RefPage>2068-9</RefPage>
        <RefTotal>Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014 Jul;30(14):2068-9. DOI: 10.1093&#47;bioinformatics&#47;btu153</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1093&#47;bioinformatics&#47;btu153</RefLink>
      </Reference>
      <Reference refNo="10">
        <RefAuthor>Gunzer F</RefAuthor>
        <RefAuthor>Rudolph WW</RefAuthor>
        <RefAuthor>Bunk B</RefAuthor>
        <RefAuthor>Schober I</RefAuthor>
        <RefAuthor>Peters S</RefAuthor>
        <RefAuthor>M&#252;ller T</RefAuthor>
        <RefAuthor>Oberheitmann B</RefAuthor>
        <RefAuthor>Schr&#246;ttner P</RefAuthor>
        <RefTitle>Whole-genome sequencing of a large collection of Myroides odoratimimus and Myroides odoratus isolates and antimicrobial susceptibility studies</RefTitle>
        <RefYear>2018</RefYear>
        <RefJournal>Emerg Microbes Infect</RefJournal>
        <RefPage>61</RefPage>
        <RefTotal>Gunzer F, Rudolph WW, Bunk B, Schober I, Peters S, M&#252;ller T, Oberheitmann B, Schr&#246;ttner P. Whole-genome sequencing of a large collection of Myroides odoratimimus and Myroides odoratus isolates and antimicrobial susceptibility studies. Emerg Microbes Infect. 2018 Apr;7(1):61. DOI: 10.1038&#47;s41426-018-0061-x</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1038&#47;s41426-018-0061-x</RefLink>
      </Reference>
      <Reference refNo="11">
        <RefAuthor>Alcock BP</RefAuthor>
        <RefAuthor>Raphenya AR</RefAuthor>
        <RefAuthor>Lau TTY</RefAuthor>
        <RefAuthor>Tsang KK</RefAuthor>
        <RefAuthor>Bouchard M</RefAuthor>
        <RefAuthor>Edalatmand A</RefAuthor>
        <RefAuthor>Huynh W</RefAuthor>
        <RefAuthor>Nguyen AV</RefAuthor>
        <RefAuthor>Cheng AA</RefAuthor>
        <RefAuthor>Liu S</RefAuthor>
        <RefAuthor>Min SY</RefAuthor>
        <RefAuthor>Miroshnichenko A</RefAuthor>
        <RefAuthor>Tran HK</RefAuthor>
        <RefAuthor>Werfalli RE</RefAuthor>
        <RefAuthor>Nasir JA</RefAuthor>
        <RefAuthor>Oloni M</RefAuthor>
        <RefAuthor>Speicher DJ</RefAuthor>
        <RefAuthor>Florescu A</RefAuthor>
        <RefAuthor>Singh B</RefAuthor>
        <RefAuthor>Faltyn M</RefAuthor>
        <RefAuthor>Hernandez-Koutoucheva A</RefAuthor>
        <RefAuthor>Sharma AN</RefAuthor>
        <RefAuthor>Bordeleau E</RefAuthor>
        <RefAuthor>Pawlowski AC</RefAuthor>
        <RefAuthor>Zubyk HL</RefAuthor>
        <RefAuthor>Dooley D</RefAuthor>
        <RefAuthor>Griffiths E</RefAuthor>
        <RefAuthor>Maguire F</RefAuthor>
        <RefAuthor>Winsor GL</RefAuthor>
        <RefAuthor>Beiko RG</RefAuthor>
        <RefAuthor>Brinkman FSL</RefAuthor>
        <RefAuthor>Hsiao WWL</RefAuthor>
        <RefAuthor>Domselaar GV</RefAuthor>
        <RefAuthor>McArthur AG</RefAuthor>
        <RefTitle>CARD 2020: antibiotic resistome surveillance with the comprehensive antibiotic resistance database</RefTitle>
        <RefYear>2020</RefYear>
        <RefJournal>Nucleic Acids Res</RefJournal>
        <RefPage>D517-25</RefPage>
        <RefTotal>Alcock BP, Raphenya AR, Lau TTY, Tsang KK, Bouchard M, Edalatmand A, Huynh W, Nguyen AV, Cheng AA, Liu S, Min SY, Miroshnichenko A, Tran HK, Werfalli RE, Nasir JA, Oloni M, Speicher DJ, Florescu A, Singh B, Faltyn M, Hernandez-Koutoucheva A, Sharma AN, Bordeleau E, Pawlowski AC, Zubyk HL, Dooley D, Griffiths E, Maguire F, Winsor GL, Beiko RG, Brinkman FSL, Hsiao WWL, Domselaar GV, McArthur AG. CARD 2020: antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic Acids Res. 2020 Jan;48(D1):D517-25. DOI: 10.1093&#47;nar&#47;gkz935</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1093&#47;nar&#47;gkz935</RefLink>
      </Reference>
      <Reference refNo="12">
        <RefAuthor>Meier-Kolthoff JP</RefAuthor>
        <RefAuthor>G&#246;ker M</RefAuthor>
        <RefTitle>TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy</RefTitle>
        <RefYear>2019</RefYear>
        <RefJournal>Nat Commun</RefJournal>
        <RefPage>2182</RefPage>
        <RefTotal>Meier-Kolthoff JP, G&#246;ker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat Commun. 2019 May;10(1):2182. DOI: 10.1038&#47;s41467-019-10210-3</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1038&#47;s41467-019-10210-3</RefLink>
      </Reference>
      <Reference refNo="13">
        <RefAuthor>Richter M</RefAuthor>
        <RefAuthor>Rossell&#243;-M&#243;ra R</RefAuthor>
        <RefTitle>Shifting the genomic gold standard for the prokaryotic species definition</RefTitle>
        <RefYear>2009</RefYear>
        <RefJournal>Proc Natl Acad Sci U S A</RefJournal>
        <RefPage>19126-31</RefPage>
        <RefTotal>Richter M, Rossell&#243;-M&#243;ra R. Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci U S A. 2009 Nov;106(45):19126-31. DOI: 10.1073&#47;pnas.0906412106</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1073&#47;pnas.0906412106</RefLink>
      </Reference>
      <Reference refNo="14">
        <RefAuthor>Morris JG Jr</RefAuthor>
        <RefAuthor>Miller HG</RefAuthor>
        <RefAuthor>Wilson R</RefAuthor>
        <RefAuthor>Tacket CO</RefAuthor>
        <RefAuthor>Hollis DG</RefAuthor>
        <RefAuthor>Hickman FW</RefAuthor>
        <RefAuthor>Weaver RE</RefAuthor>
        <RefAuthor>Blake PA</RefAuthor>
        <RefTitle>Illness caused by Vibrio damsela and Vibrio hollisae</RefTitle>
        <RefYear>1982</RefYear>
        <RefJournal>Lancet</RefJournal>
        <RefPage>1294-7</RefPage>
        <RefTotal>Morris JG Jr, Miller HG, Wilson R, Tacket CO, Hollis DG, Hickman FW, Weaver RE, Blake PA. Illness caused by Vibrio damsela and Vibrio hollisae. Lancet. 1982 Jun;1(8284):1294-7. DOI: 10.1016&#47;s0140-6736(82)92853-7</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1016&#47;s0140-6736(82)92853-7</RefLink>
      </Reference>
      <Reference refNo="15">
        <RefAuthor>Pawelec G</RefAuthor>
        <RefTitle>Age and immunity: What is &#8220;immunosenescence&#8221;&#63;</RefTitle>
        <RefYear>2018</RefYear>
        <RefJournal>Exp Gerontol</RefJournal>
        <RefPage>4-9</RefPage>
        <RefTotal>Pawelec G. Age and immunity: What is &#8220;immunosenescence&#8221;&#63; Exp Gerontol. 2018 May;105:4-9. DOI: 10.1016&#47;j.exger.2017.10.024</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1016&#47;j.exger.2017.10.024</RefLink>
      </Reference>
      <Reference refNo="16">
        <RefAuthor>Yuen KY</RefAuthor>
        <RefAuthor>Ma L</RefAuthor>
        <RefAuthor>Wong SS</RefAuthor>
        <RefAuthor>Ng WF</RefAuthor>
        <RefTitle>Fatal necrotizing fasciitis due to Vibrio damsela</RefTitle>
        <RefYear>1993</RefYear>
        <RefJournal>Scand J Infect Dis</RefJournal>
        <RefPage>659-61</RefPage>
        <RefTotal>Yuen KY, Ma L, Wong SS, Ng WF. Fatal necrotizing fasciitis due to Vibrio damsela. Scand J Infect Dis. 1993;25(5):659-61. DOI: 10.3109&#47;00365549309008557</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.3109&#47;00365549309008557</RefLink>
      </Reference>
      <Reference refNo="17">
        <RefAuthor>Yamane K</RefAuthor>
        <RefAuthor>Asato J</RefAuthor>
        <RefAuthor>Kawade N</RefAuthor>
        <RefAuthor>Takahashi H</RefAuthor>
        <RefAuthor>Kimura B</RefAuthor>
        <RefAuthor>Arakawa Y</RefAuthor>
        <RefTitle>Two cases of fatal necrotizing fasciitis caused by Photobacterium damsela in Japan</RefTitle>
        <RefYear>2004</RefYear>
        <RefJournal>J Clin Microbiol</RefJournal>
        <RefPage>1370-2</RefPage>
        <RefTotal>Yamane K, Asato J, Kawade N, Takahashi H, Kimura B, Arakawa Y. Two cases of fatal necrotizing fasciitis caused by Photobacterium damsela in Japan. J Clin Microbiol. 2004 Mar;42(3):1370-2. DOI: 10.1128&#47;jcm.42.3.1370-1372.2004</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1128&#47;jcm.42.3.1370-1372.2004</RefLink>
      </Reference>
      <Reference refNo="18">
        <RefAuthor>Jana S</RefAuthor>
        <RefAuthor>Deb JK</RefAuthor>
        <RefTitle>Molecular understanding of aminoglycoside action and resistance</RefTitle>
        <RefYear>2006</RefYear>
        <RefJournal>Appl Microbiol Biotechnol</RefJournal>
        <RefPage>140-50</RefPage>
        <RefTotal>Jana S, Deb JK. Molecular understanding of aminoglycoside action and resistance. Appl Microbiol Biotechnol. 2006 Mar;70(2):140-50. DOI: 10.1007&#47;s00253-005-0279-0</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1007&#47;s00253-005-0279-0</RefLink>
      </Reference>
      <Reference refNo="19">
        <RefAuthor>Fraser SL</RefAuthor>
        <RefAuthor>Purcell BK</RefAuthor>
        <RefAuthor>Delgado B Jr</RefAuthor>
        <RefAuthor>Baker AE</RefAuthor>
        <RefAuthor>Whelen AC</RefAuthor>
        <RefTitle>Rapidly fatal infection due to Photobacterium (Vibrio) damsela</RefTitle>
        <RefYear>1997</RefYear>
        <RefJournal>Clin Infect Dis</RefJournal>
        <RefPage>935-6</RefPage>
        <RefTotal>Fraser SL, Purcell BK, Delgado B Jr, Baker AE, Whelen AC. Rapidly fatal infection due to Photobacterium (Vibrio) damsela. Clin Infect Dis. 1997 Oct;25(4):935-6. DOI: 10.1086&#47;597647</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1086&#47;597647</RefLink>
      </Reference>
      <Reference refNo="20">
        <RefAuthor>Asato J</RefAuthor>
        <RefAuthor>Kanaya F</RefAuthor>
        <RefTitle>Fatal infection of the hand due to Photobacterium damsela: a case report</RefTitle>
        <RefYear>2004</RefYear>
        <RefJournal>Clin Infect Dis</RefJournal>
        <RefPage>e100-1</RefPage>
        <RefTotal>Asato J, Kanaya F. Fatal infection of the hand due to Photobacterium damsela: a case report. Clin Infect Dis. 2004 May;38(10):e100-1. DOI: 10.1086&#47;383468</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1086&#47;383468</RefLink>
      </Reference>
      <Reference refNo="21">
        <RefAuthor>Hundenborn J</RefAuthor>
        <RefAuthor>Thurig S</RefAuthor>
        <RefAuthor>Kommerell M</RefAuthor>
        <RefAuthor>Haag H</RefAuthor>
        <RefAuthor>Nolte O</RefAuthor>
        <RefTitle>Severe Wound Infection with Photobacterium damselae ssp. damselae and Vibrio harveyi, following a Laceration Injury in Marine Environment: A Case Report and Review of the Literature</RefTitle>
        <RefYear>2013</RefYear>
        <RefJournal>Case Rep Med</RefJournal>
        <RefPage>610632</RefPage>
        <RefTotal>Hundenborn J, Thurig S, Kommerell M, Haag H, Nolte O. Severe Wound Infection with Photobacterium damselae ssp. damselae and Vibrio harveyi, following a Laceration Injury in Marine Environment: A Case Report and Review of the Literature. Case Rep Med. 2013;2013:610632. DOI: 10.1155&#47;2013&#47;610632</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1155&#47;2013&#47;610632</RefLink>
      </Reference>
      <Reference refNo="22">
        <RefAuthor>Alvarez JR</RefAuthor>
        <RefAuthor>Lamba S</RefAuthor>
        <RefAuthor>Dyer KY</RefAuthor>
        <RefAuthor>Apuzzio JJ</RefAuthor>
        <RefTitle>An unusual case of urinary tract infection in a pregnant woman with Photobacterium damsela</RefTitle>
        <RefYear>2006</RefYear>
        <RefJournal>Infect Dis Obstet Gynecol</RefJournal>
        <RefPage>80682</RefPage>
        <RefTotal>Alvarez JR, Lamba S, Dyer KY, Apuzzio JJ. An unusual case of urinary tract infection in a pregnant woman with Photobacterium damsela. Infect Dis Obstet Gynecol. 2006;2006:80682. DOI: 10.1155&#47;IDOG&#47;2006&#47;80682</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1155&#47;IDOG&#47;2006&#47;80682</RefLink>
      </Reference>
      <Reference refNo="23">
        <RefAuthor>Goodell KH</RefAuthor>
        <RefAuthor>Jordan MR</RefAuthor>
        <RefAuthor>Graham R</RefAuthor>
        <RefAuthor>Cassidy C</RefAuthor>
        <RefAuthor>Nasraway SA</RefAuthor>
        <RefTitle>Rapidly advancing necrotizing fasciitis caused by Photobacterium (Vibrio) damsela: a hyperaggressive variant</RefTitle>
        <RefYear>2004</RefYear>
        <RefJournal>Crit Care Med</RefJournal>
        <RefPage>278-81</RefPage>
        <RefTotal>Goodell KH, Jordan MR, Graham R, Cassidy C, Nasraway SA. Rapidly advancing necrotizing fasciitis caused by Photobacterium (Vibrio) damsela: a hyperaggressive variant. Crit Care Med. 2004 Jan;32(1):278-81. DOI: 10.1097&#47;01.CCM.0000104920.01254.82</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1097&#47;01.CCM.0000104920.01254.82</RefLink>
      </Reference>
      <Reference refNo="24">
        <RefAuthor>Knight-Madden JM</RefAuthor>
        <RefAuthor>Barton M</RefAuthor>
        <RefAuthor>Gandretti N</RefAuthor>
        <RefAuthor>Nicholson AM</RefAuthor>
        <RefTitle>Photobacterium damsela bacteremia in a child with sickle-cell disease</RefTitle>
        <RefYear>2005</RefYear>
        <RefJournal>Pediatr Infect Dis J</RefJournal>
        <RefPage>654-5</RefPage>
        <RefTotal>Knight-Madden JM, Barton M, Gandretti N, Nicholson AM. Photobacterium damsela bacteremia in a child with sickle-cell disease. Pediatr Infect Dis J. 2005 Jul;24(7):654-5. DOI: 10.1097&#47;01.inf.0000168845.26758.e3</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1097&#47;01.inf.0000168845.26758.e3</RefLink>
      </Reference>
      <Reference refNo="25">
        <RefAuthor>Nakamura Y</RefAuthor>
        <RefAuthor>Uchihira M</RefAuthor>
        <RefAuthor>Ichimiya M</RefAuthor>
        <RefAuthor>Morita K</RefAuthor>
        <RefAuthor>Muto M</RefAuthor>
        <RefTitle>Necrotizing fasciitis of the leg due to Photobacterium damsela</RefTitle>
        <RefYear>2008</RefYear>
        <RefJournal>J Dermatol</RefJournal>
        <RefPage>44-5</RefPage>
        <RefTotal>Nakamura Y, Uchihira M, Ichimiya M, Morita K, Muto M. Necrotizing fasciitis of the leg due to Photobacterium damsela. J Dermatol. 2008 Jan;35(1):44-5. DOI: 10.1111&#47;j.1346-8138.2007.00412.x</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1111&#47;j.1346-8138.2007.00412.x</RefLink>
      </Reference>
      <Reference refNo="26">
        <RefAuthor>Barber GR</RefAuthor>
        <RefAuthor>Swygert JS</RefAuthor>
        <RefTitle>Necrotizing fasciitis due to Photobacterium damsela in a man lashed by a stingray</RefTitle>
        <RefYear>2000</RefYear>
        <RefJournal>N Engl J Med</RefJournal>
        <RefPage>824</RefPage>
        <RefTotal>Barber GR, Swygert JS. Necrotizing fasciitis due to Photobacterium damsela in a man lashed by a stingray. N Engl J Med. 2000 Mar;342(11):824. DOI: 10.1056&#47;NEJM200003163421118</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1056&#47;NEJM200003163421118</RefLink>
      </Reference>
      <Reference refNo="27">
        <RefAuthor>Kim HR</RefAuthor>
        <RefAuthor>Kim JW</RefAuthor>
        <RefAuthor>Lee MK</RefAuthor>
        <RefAuthor>Kim JG</RefAuthor>
        <RefTitle>Septicemia progressing to fatal hepatic dysfunction in an cirrhotic patient after oral ingestion of Photobacterium damsela: a case report</RefTitle>
        <RefYear>2009</RefYear>
        <RefJournal>Infection</RefJournal>
        <RefPage>555-6</RefPage>
        <RefTotal>Kim HR, Kim JW, Lee MK, Kim JG. Septicemia progressing to fatal hepatic dysfunction in an cirrhotic patient after oral ingestion of Photobacterium damsela: a case report. Infection. 2009 Dec;37(6):555-6. DOI: 10.1007&#47;s15010-009-9049-8</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1007&#47;s15010-009-9049-8</RefLink>
      </Reference>
      <Reference refNo="28">
        <RefAuthor>Clarridge JE</RefAuthor>
        <RefAuthor>Zighelboim-Daum S</RefAuthor>
        <RefTitle>Isolation and characterization of two hemolytic phenotypes of Vibrio damsela associated with a fatal wound infection</RefTitle>
        <RefYear>1985</RefYear>
        <RefJournal>J Clin Microbiol</RefJournal>
        <RefPage>302-6</RefPage>
        <RefTotal>Clarridge JE, Zighelboim-Daum S. Isolation and characterization of two hemolytic phenotypes of Vibrio damsela associated with a fatal wound infection. J Clin Microbiol. 1985 Mar;21(3):302-6. DOI: 10.1128&#47;JCM.21.3.302-306.1985</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1128&#47;JCM.21.3.302-306.1985</RefLink>
      </Reference>
      <Reference refNo="29">
        <RefAuthor>Coffey JA Jr</RefAuthor>
        <RefAuthor>Harris RL</RefAuthor>
        <RefAuthor>Rutledge ML</RefAuthor>
        <RefAuthor>Bradshaw MW</RefAuthor>
        <RefAuthor>Williams TW Jr</RefAuthor>
        <RefTitle>Vibrio damsela: another potentially virulent marine vibrio</RefTitle>
        <RefYear>1986</RefYear>
        <RefJournal>Infect Dis</RefJournal>
        <RefPage>800-2</RefPage>
        <RefTotal>Coffey JA Jr, Harris RL, Rutledge ML, Bradshaw MW, Williams TW Jr. Vibrio damsela: another potentially virulent marine vibrio. Infect Dis. 1986 Apr;153(4):800-2. DOI: 10.1093&#47;infdis&#47;153.4.800-a</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1093&#47;infdis&#47;153.4.800-a</RefLink>
      </Reference>
      <Reference refNo="30">
        <RefAuthor>Shin JH</RefAuthor>
        <RefAuthor>Shin MG</RefAuthor>
        <RefAuthor>Suh SP</RefAuthor>
        <RefAuthor>Ryang DW</RefAuthor>
        <RefAuthor>Rew JS</RefAuthor>
        <RefAuthor>Nolte FS</RefAuthor>
        <RefTitle>Primary Vibrio damsela septicemia</RefTitle>
        <RefYear>1996</RefYear>
        <RefJournal>Clin Infect Dis</RefJournal>
        <RefPage>856-7</RefPage>
        <RefTotal>Shin JH, Shin MG, Suh SP, Ryang DW, Rew JS, Nolte FS. Primary Vibrio damsela septicemia. Clin Infect Dis. 1996 May;22(5):856-7. DOI: 10.1093&#47;clinids&#47;22.5.856</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1093&#47;clinids&#47;22.5.856</RefLink>
      </Reference>
      <Reference refNo="31">
        <RefAuthor>Akram A</RefAuthor>
        <RefAuthor>Stevens RP</RefAuthor>
        <RefAuthor>Konecny P</RefAuthor>
        <RefTitle>Photobacterium damselae and Vibrio harveyi hand infection from marine exposure</RefTitle>
        <RefYear>2015</RefYear>
        <RefJournal>Med J Aust</RefJournal>
        <RefPage>224-5</RefPage>
        <RefTotal>Akram A, Stevens RP, Konecny P. Photobacterium damselae and Vibrio harveyi hand infection from marine exposure. Med J Aust. 2015 Sep;203(5):224-5.e1. DOI: 10.5694&#47;mja15.00179</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.5694&#47;mja15.00179</RefLink>
      </Reference>
      <Reference refNo="32">
        <RefAuthor>Perez-Tirse J</RefAuthor>
        <RefAuthor>Levine JF</RefAuthor>
        <RefAuthor>Mecca M</RefAuthor>
        <RefTitle>Vibrio damsela. A cause of fulminant septicemia</RefTitle>
        <RefYear>1993</RefYear>
        <RefJournal>Arch Intern Med</RefJournal>
        <RefPage>1838-40</RefPage>
        <RefTotal>Perez-Tirse J, Levine JF, Mecca M. Vibrio damsela. A cause of fulminant septicemia. Arch Intern Med. 1993 Aug;153(15):1838-40. DOI: 10.1001&#47;archinte.153.15.1838</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1001&#47;archinte.153.15.1838</RefLink>
      </Reference>
      <Reference refNo="33">
        <RefAuthor>Tang WM</RefAuthor>
        <RefAuthor>Wong JW</RefAuthor>
        <RefTitle>Necrotizing fasciitis caused by Vibrio damsela</RefTitle>
        <RefYear>1999</RefYear>
        <RefJournal>Orthopedics</RefJournal>
        <RefPage>443-4</RefPage>
        <RefTotal>Tang WM, Wong JW. Necrotizing fasciitis caused by Vibrio damsela. Orthopedics. 1999 Apr;22(4):443-4.</RefTotal>
      </Reference>
      <Reference refNo="34">
        <RefAuthor>Aigbivbalu L</RefAuthor>
        <RefAuthor>Maraqa N</RefAuthor>
        <RefTitle>Photobacterium damsela wound infection in a 14-year-old surfer</RefTitle>
        <RefYear>2009</RefYear>
        <RefJournal>South Med J</RefJournal>
        <RefPage>425-6</RefPage>
        <RefTotal>Aigbivbalu L, Maraqa N. Photobacterium damsela wound infection in a 14-year-old surfer. South Med J. 2009 Apr;102(4):425-6. DOI: 10.1097&#47;SMJ.0b013e31819b9491</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.1097&#47;SMJ.0b013e31819b9491</RefLink>
      </Reference>
      <Reference refNo="35">
        <RefAuthor>Dryden M</RefAuthor>
        <RefAuthor>Legarde M</RefAuthor>
        <RefAuthor>Gottlieb T</RefAuthor>
        <RefAuthor>Brady L</RefAuthor>
        <RefAuthor>Ghosh HK</RefAuthor>
        <RefTitle>Vibrio damsela wound infections in Australia</RefTitle>
        <RefYear>1989</RefYear>
        <RefJournal>Med J Aust</RefJournal>
        <RefPage>540-1</RefPage>
        <RefTotal>Dryden M, Legarde M, Gottlieb T, Brady L, Ghosh HK. Vibrio damsela wound infections in Australia. Med J Aust. 1989 Nov;151(9):540-1.</RefTotal>
      </Reference>
      <Reference refNo="36">
        <RefAuthor>Sahu KK</RefAuthor>
        <RefAuthor>Sherif AA</RefAuthor>
        <RefAuthor>Davaro R</RefAuthor>
        <RefTitle>A Rare Cause of Cellulitis: Photobacterium damselae</RefTitle>
        <RefYear>2020</RefYear>
        <RefJournal>J Microsc Ultrastruct</RefJournal>
        <RefPage>25-26</RefPage>
        <RefTotal>Sahu KK, Sherif AA, Davaro R. A Rare Cause of Cellulitis: Photobacterium damselae. J Microsc Ultrastruct. 2020 Jan-Mar;8(1):25-26. DOI: 10.4103&#47;JMAU.JMAU&#95;63&#95;18</RefTotal>
        <RefLink>https:&#47;&#47;doi.org&#47;10.4103&#47;JMAU.JMAU&#95;63&#95;18</RefLink>
      </Reference>
    </References>
    <Media>
      <Tables>
        <Table format="png">
          <MediaNo>1</MediaNo>
          <MediaID>1</MediaID>
          <Caption><Pgraph><Mark1>Table 1: Overview of reports on human infections caused by </Mark1><Mark1><Mark2>Photobacterium damselae</Mark2></Mark1> </Pgraph></Caption>
        </Table>
        <NoOfTables>1</NoOfTables>
      </Tables>
      <Figures>
        <Figure format="png" height="698" width="690">
          <MediaNo>1</MediaNo>
          <MediaID>1</MediaID>
          <Caption><Pgraph><Mark1>Figure 1: </Mark1><Mark1><Mark2>Photobacterium dampselae</Mark2></Mark1><Mark1> DSM 110634 growing on Columbia blood agar containing 5&#37; sheep blood (Oxoid, Wesel, Germany). The bacteria were incubated for 18 hours.</Mark1></Pgraph></Caption>
        </Figure>
        <NoOfPictures>1</NoOfPictures>
      </Figures>
      <InlineFigures>
        <NoOfPictures>0</NoOfPictures>
      </InlineFigures>
      <Attachments>
        <NoOfAttachments>0</NoOfAttachments>
      </Attachments>
    </Media>
  </OrigData>
</GmsArticle>