dgkh000225
10.3205/dgkh000225
urn:nbn:de:0183-dgkh0002251
Research Article
Is the mazEF toxin-antitoxin system responsible for vancomycin resistance in clinical isolates of Enterococcus faecalis?
Ist das mazEF Toxin-Antitoxin-System verantwortlich für die Vancomycinresistenz klinischer Isolate von Enterococcus faecalis?
Sadeghifard
Sadeghifard
Nourkhoda
N
Department of Medical Microbiology, University Putra Malaysia, Malaysia
author
Soheili
Soheili
Sara
S
Department of Medical Microbiology, University Putra Malaysia, Malaysia
author
Sekawi
Sekawi
Zamberi
Z
Department of Medical Microbiology, University Putra Malaysia, Malaysia
author
Ghafourian
Ghafourian
Sobhan
S
Department of Medical Microbiology, University Putra Malaysia, MalaysiaDepartment of Medical Microbiology, University Putra Malaysia, Malaysia
sobhanghafurian@yahoo.com
author
German Medical Science GMS Publishing House
Düsseldorf
610
Enterococcus
mazEF TA system
vancomycin
antimicrobial target
Enterococcus
mazEF AT-System
Vancomycin
antimikrobielles Target
20140307
engl
2196-5226
9
1
GMS Hygiene and Infection Control
GMS Hyg Infect Control
05
In der vorliegenden Studie sollte der Zusammenhang zwischen der Vancomycinresistenz bei Enterococcus faecalis (VRE) und dem Vorkommen des mazEF Toxin-Antitoxin(TA)-Systems untersucht werden, um Hinweise für eine neue antimikrobielle Targettherapie zu erhalten. Die Empfindlichkeit der Enterkokokken wurde mittels MIC, das Vorkommen des mazEF TA-Systems mittels PCR bestimmt. Unter 200 Enterokokkenisolaten waren 39,5% resistent gegen Vancomycin (VRE), während 60,5% sensibel waren. Das mazEF TA-System war bei allen VRE-Isolaten positiv, aber weniger prävalent bei den VSE-Isolaten (38/121, 31,4%). Die Analyse ergab einen Zusammenhang zwischen dem Vorkommen des VRE-Resistenzgens und dem mazEF TA-System, was für weitere Untersuchungen in Hinblick auf ein neues antimikrobielles Ziel gegenüber Enterokokken hilfreich ist.
The current study was conducted to investigate the relationship between vancomycin-resistant Enterococcus faecalis (VRE) and the presence of mazEF toxin-antitoxin (TA) system, which may be useful as target for novel antimicrobial therapy concepts. The susceptibility of E. faecalis was determined by MIC, and the presence of the mazEF TA system was evaluated by PCR. Among 200 E. faecalis isolates 39.5% showed resistance to vancomycin (VRE), while 60.5% were susceptible strains (VSE). The mazEF TA system was positive in all VRE isolates (100%), but less prevalent (38/121, 31.4%) among the 121 VSE strains. In conclusion, our study demonstrated a positive relationship between the presence of vancomycin resistance and mazEF TA system. This observation may introduce therapeutic options against a novel antimicrobial target in enterococci.
IntroductionEnterococcus is one of the important organisms which is responsible for clinical infections such as urinary tract infections, bacteremia, bacterial endocarditis, diverticulitis, and meningitis . Enterococcus antibiotic sensitive strains can be treated with β-lactam antibiotics such as ampicillin and glycopeptides such as vancomycin . Regretfully, resistance against antibiotics is increasing globally . In the last two decades, vancomycin resistance of enterococci has emerged increasingly in nosocomial infections of hospitalized patients . Mobile genetic elements are responsible for the vancomycin resistance in enterococci . Despite the frequency of plasmid resistance among vancomycin-resistant enterococci (VRE) isolates is not obvious, there are multiple reports of plasmids with the various vancomycin resistant genes clusters. Some plasmids harbor loci encoded post-segregation killing systems , which encode a toxin and its corresponding antitoxin. The analysis showed that this system could be vertically transferred. The antitoxin is unstable; however, the toxin is stable, which adds to post-segregation killing systems . Interestingly, the stable toxin may trigger bacteriostasis among VRE strains.The current study was conducted to explain the relationship between vancomycin resistance of Enterococcus faecalis and the presence of mazEF TA system, which may be useful as target for novel antimicrobial therapy concepts.
MethodsBacterial isolates and identification Two hundred isolates of Enterococcus faecalis were collected during September 2011 and April 2012 in Ilam Hospital in the West of Iran and Milad Hospital in Tehran, the capital of Iran. The isolates were obtained from patients with urinary tract infection. The Enterococcus faecalis identification was performed by Gram staining, motility assessment, catalase production, growth in 6.5% NaCl, xylose, mannitol, arabinose, sorbitol use, bile, and esculin growth. Strains were additionally tested for hydrolysis, pigment production, leucine aminopeptidase activity, and acidification of methyl-a-D-glucopyranoside .Determination of vancomycin-resistant Enterococcus (VRE)Minimum inhibitory concentrations (MICs) were assessed by microdilution in Mueller-Hinton broth. MICs of vancomycin were defined as being resistant to vancomycin with an MIC ≥8 µg/mL . E. faecalis ATCC 51299 was used as positive control .Determination of the MazEF TA system The specific primers were designed for mazEF TA loci to amplify 505 bp oligonucleotide. The primer sequences of PCR primers were as belows: Forward: 5-<![CDATA[ATGATCCACAGTAGCGTAAAGCGT</PlainText></TextGroup>-3; Reverse: 5-<TextGroup><PlainText>TTACCAGACTTCCTTATCTTTCGG</PlainText></TextGroup>-3.</Pgraph><Pgraph>The PCR amplification was carried out in a final volume of 25 µl with 3 µl of DNA as a template, 2.5 µl PCR buffer (20 mM Tris-HCl/50 mM KCl, pH 8.4), 1.5 mM MgCl2, <TextGroup><PlainText>1 mM</PlainText></TextGroup> each deoxynucleoside triphosphate, 1 µM each primer, and 2 units of <Mark2>Taq</Mark2> polymerase. The PCR was performed with an initial denaturation in 95°C for <TextGroup><PlainText>2 minutes</PlainText></TextGroup> and 35 cycles of denaturation in 94°C for <TextGroup><PlainText>1 minute</PlainText></TextGroup>, annealing in 58°C for 45 seconds, and extension in 72°C for 30 seconds, following in a final extension step in 72°C for 10 minutes. Then, the PCR products were analyzed by 1% agarose gel electrophoresis.</Pgraph></TextBlock>
<TextBlock linked="yes" name="Results">
<MainHeadline>Results</MainHeadline><SubHeadline>Prevalence of VRE </SubHeadline><Pgraph>Among the 200 <Mark2>E. faecalis</Mark2> isolates (Table 1 <ImgLink imgNo="1" imgType="table"/>), 39.5% of the isolates showed resistance to vancomycin (VRE), while 60.5% were susceptible to vancomycin (VSE) (Figure 1 <ImgLink imgNo="1" imgType="figure"/>). </Pgraph><SubHeadline>Presence of the MazEF TA system </SubHeadline><Pgraph>All 200 <Mark2>E. faecalis</Mark2> strains were analyzed by PCR, and findings were designated as positive if a distinct band was found at the expected size on an agarose gel. The PCR results showed that the <Mark2>mazEF</Mark2> TA system was found in all VRE isolates (79/79, 100%), however, only in 31.4% (n=38) of the 121 VSE isolates. This difference was statistically significant (p<0.001; 2-sided Fisher’s exact test).</Pgraph></TextBlock>
<TextBlock linked="yes" name="Discussion">
<MainHeadline>Discussion</MainHeadline><Pgraph>VRE are increasingly found as responsible bacteria for a large number of nosocomial infections. VRE is known as a one of the challenging bacteria, which is able to pass its vancomycin-resistant gene to the methicillin-resistant <Mark2>Staphylococcus aureus</Mark2> (MRSA) <TextLink reference="9"></TextLink>. Although there are many isolation of VRE in hospital settings, only a little information is available on the nature of plasmid-encoded vancomycin resistance gene. The mechanism of presence and retaining of mobile genetic elements is not understood yet. </Pgraph><Pgraph>The TA systems were found on the chromosome and plasmid of bacteria. Although the function of these TA systems is not fully elucidated yet, but some researchers suggest that it is responsible for stress tolerance <TextLink reference="10"></TextLink>, <TextLink reference="11"></TextLink>. The TA loci were found in plasmid of many Gram negative bacteria, and best characterized in <Mark2>Escherichia coli</Mark2> <TextLink reference="12"></TextLink>. The plasmid role of TA loci is in post-segregation killing that by disruption of antitoxin can cause suicide in bacteria <TextLink reference="13"></TextLink>. </Pgraph><Pgraph>The <Mark2>mazEF</Mark2> TA system was first found in the chromosome of <Mark2>E. coli</Mark2> <TextLink reference="13"></TextLink>. The <Mark2>mazE</Mark2> is antitoxin and <Mark2>mazF</Mark2> is toxin and stable. The <Mark2>mazE</Mark2> is degraded with ClpA protease; therefore, in the absence of the genes encoding <Mark2>mazEF</Mark2>, the <Mark2>mazE</Mark2> will be degraded and MazF can kill the cell. The MazF toxin is an endoribonuclease, which is specific for ACA sequences <TextLink reference="14"></TextLink>, <TextLink reference="15"></TextLink>.</Pgraph><Pgraph>Our results demonstrate that the <Mark2>mazEF</Mark2> was positive in all VRE isolates (100%), but less prevalent (38/121, 31.4%) among the 121 VSE strains. The analysis showed resistance to vancomycin possibility harbored by plasmid containing TA loci. However, our analysis showed high prevalence of VRE also <Mark2>mazEF</Mark2> in strains isolated in Milad hospital. Interestingly, <Mark2>mazEF</Mark2> only were found in VSE, which collected in Milad hospital. All the VRE were positive for <Mark2>mazEF</Mark2> but in 31.4% of VSE were positive that may associate with the others antibiotics that not studied in current research. When the TA system contains on plasmid during binary fission, the results will be a survived daughter cells that inherit the plasmid. The daughter cell that does not inherit the plasmid harboring TA system will be killed. Because of the degradation of antitoxin, the stable toxin kills the cell. This is called “post-segregational killing” (PSK) <TextLink reference="16"></TextLink>. By this way, bacteria that contain the TA loci on plasmid (commonly these plasmids also harbored the antibiotic resistance genes) will be survived and the bacteria without plasmid containing TA loci and so do not have the antibiotic resistant genes will be died. Our results suggested by activation of toxin (<Mark2>mazF</Mark2>) in VRE strain, it can be interesting target for antimicrobial therapy.</Pgraph></TextBlock>
<TextBlock linked="yes" name="Conclusion">
<MainHeadline>Conclusion</MainHeadline><Pgraph>Our study demonstrated a positive relationship between the presence of vancomycin resistance and <Mark2>mazEF</Mark2> TA system. This observation may introduce therapeutic options against a novel antimicrobial target in enterococci.</Pgraph></TextBlock>
<TextBlock linked="yes" name="Notes">
<MainHeadline>Notes</MainHeadline><SubHeadline>Competing interests</SubHeadline><Pgraph>The authors declare that they have no competing interests.</Pgraph></TextBlock>
<References linked="yes">
<Reference refNo="1">
<RefAuthor>Fisher K</RefAuthor>
<RefAuthor>Phillips C</RefAuthor>
<RefTitle>The ecology, epidemiology and virulence of Enterococcus</RefTitle>
<RefYear>2009</RefYear>
<RefJournal>Microbiology (Reading, Engl)</RefJournal>
<RefPage>1749-57</RefPage>
<RefTotal>Fisher K, Phillips C. The ecology, epidemiology and virulence of Enterococcus. Microbiology (Reading, Engl). 2009 Jun;155(Pt 6):1749-57. DOI: 10.1099/mic.0.026385-0</RefTotal>
<RefLink>http://dx.doi.org/10.1099/mic.0.026385-0</RefLink>
</Reference>
<Reference refNo="2">
<RefAuthor>Pelletier LL</RefAuthor>
<RefTitle>Microbiology of the Circulatory System</RefTitle>
<RefYear>1996</RefYear>
<RefBookTitle>Medical Microbiology</RefBookTitle>
<RefPage>Chapter 94</RefPage>
<RefTotal>Pelletier LL. Microbiology of the Circulatory System. In: Baron S, ed. Medical Microbiology. 4th ed. Galveston (TX): University of Texas Medical Branch at Galveston; 1996. Chapter 94. Available from: http://www.ncbi.nlm.nih.gov/books/NBK8290/</RefTotal>
<RefLink>http://www.ncbi.nlm.nih.gov/books/NBK8290/</RefLink>
</Reference>
<Reference refNo="3">
<RefAuthor>Ryan KJ</RefAuthor>
<RefAuthor>Ray CG</RefAuthor>
<RefTitle></RefTitle>
<RefYear>2004</RefYear>
<RefBookTitle>Sherris Medical Microbiology</RefBookTitle>
<RefPage>294-5</RefPage>
<RefTotal>Ryan KJ, Ray CG. Sherris Medical Microbiology. 4th ed. New York: McGraw Hill; 2004. ISBN 0-8385-8529-9. p. 294-5.</RefTotal>
</Reference>
<Reference refNo="4">
<RefAuthor>Tomita H</RefAuthor>
<RefAuthor>Tanimoto K</RefAuthor>
<RefAuthor>Hayakawa S</RefAuthor>
<RefAuthor>Morinaga K</RefAuthor>
<RefAuthor>Ezaki K</RefAuthor>
<RefAuthor>Oshima H</RefAuthor>
<RefAuthor>Ike Y</RefAuthor>
<RefTitle>Highly conjugative pMG1-like plasmids carrying Tn1546-like transposons that encode vancomycin resistance in Enterococcus faecium</RefTitle>
<RefYear>2003</RefYear>
<RefJournal>J Bacteriol</RefJournal>
<RefPage>7024-8</RefPage>
<RefTotal>Tomita H, Tanimoto K, Hayakawa S, Morinaga K, Ezaki K, Oshima H, Ike Y. Highly conjugative pMG1-like plasmids carrying Tn1546-like transposons that encode vancomycin resistance in Enterococcus faecium. J Bacteriol. 2003 Dec;185(23):7024-8. DOI: 10.1128/JB.185.23.7024-7028.2003</RefTotal>
<RefLink>http://dx.doi.org/10.1128/JB.185.23.7024-7028.2003</RefLink>
</Reference>
<Reference refNo="5">
<RefAuthor>Hasman H</RefAuthor>
<RefAuthor>Villadsen AG</RefAuthor>
<RefAuthor>Aarestrup FM</RefAuthor>
<RefTitle>Diversity and stability of plasmids from glycopeptide-resistant Enterococcus faecium (GRE) isolated from pigs in Denmark</RefTitle>
<RefYear>2005</RefYear>
<RefJournal>Microb Drug Resist</RefJournal>
<RefPage>178-84</RefPage>
<RefTotal>Hasman H, Villadsen AG, Aarestrup FM. Diversity and stability of plasmids from glycopeptide-resistant Enterococcus faecium (GRE) isolated from pigs in Denmark. Microb Drug Resist. 2005;11(2):178-84. DOI: 10.1089/mdr.2005.11.178</RefTotal>
<RefLink>http://dx.doi.org/10.1089/mdr.2005.11.178</RefLink>
</Reference>
<Reference refNo="6">
<RefAuthor>Gerdes K</RefAuthor>
<RefAuthor>Rasmussen PB</RefAuthor>
<RefAuthor>Molin S</RefAuthor>
<RefTitle>Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells</RefTitle>
<RefYear>1986</RefYear>
<RefJournal>Proc Natl Acad Sci USA</RefJournal>
<RefPage>3116-20</RefPage>
<RefTotal>Gerdes K, Rasmussen PB, Molin S. Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells. Proc Natl Acad Sci USA. 1986 May;83(10):3116-20. DOI: 10.1073/pnas.83.10.3116</RefTotal>
<RefLink>http://dx.doi.org/10.1073/pnas.83.10.3116</RefLink>
</Reference>
<Reference refNo="7">
<RefAuthor>Turenne CY</RefAuthor>
<RefAuthor>Hoban DJ</RefAuthor>
<RefAuthor>Karlowsky JA</RefAuthor>
<RefAuthor>Zhanel GG</RefAuthor>
<RefAuthor>Kabani AM</RefAuthor>
<RefTitle>Screening of stool samples for identification of vancomycin-resistant Enterococcus isolates should include the methyl-alpha-D-glucopyranoside test to differentiate nonmotile Enterococcus gallinarum from E. faecium</RefTitle>
<RefYear>1998</RefYear>
<RefJournal>J Clin Microbiol</RefJournal>
<RefPage>2333-5</RefPage>
<RefTotal>Turenne CY, Hoban DJ, Karlowsky JA, Zhanel GG, Kabani AM. Screening of stool samples for identification of vancomycin-resistant Enterococcus isolates should include the methyl-alpha-D-glucopyranoside test to differentiate nonmotile Enterococcus gallinarum from E. faecium. J Clin Microbiol. 1998 Aug;36(8):2333-5.</RefTotal>
</Reference>
<Reference refNo="8">
<RefAuthor>Clinical Laboratory Standard Institute</RefAuthor>
<RefTitle></RefTitle>
<RefYear>2011</RefYear>
<RefBookTitle>Performance standard for antimicrobial susceptibility testing: twenty-first informational supplement. M100-S21 2011</RefBookTitle>
<RefPage></RefPage>
<RefTotal>Clinical Laboratory Standard Institute. Performance standard for antimicrobial susceptibility testing: twenty-first informational supplement. M100-S21 2011. Wayne, PA: CLSI; 2011.</RefTotal>
</Reference>
<Reference refNo="9">
<RefAuthor>Weigel LM</RefAuthor>
<RefAuthor>Clewell DB</RefAuthor>
<RefAuthor>Gill SR</RefAuthor>
<RefAuthor>Clark NC</RefAuthor>
<RefAuthor>McDougal LK</RefAuthor>
<RefAuthor>Flannagan SE</RefAuthor>
<RefAuthor>Kolonay JF</RefAuthor>
<RefAuthor>Shetty J</RefAuthor>
<RefAuthor>Killgore GE</RefAuthor>
<RefAuthor>Tenover FC</RefAuthor>
<RefTitle>Genetic analysis of a high-level vancomycin-resistant isolate of Staphylococcus aureus</RefTitle>
<RefYear>2003</RefYear>
<RefJournal>Science</RefJournal>
<RefPage>1569-71</RefPage>
<RefTotal>Weigel LM, Clewell DB, Gill SR, Clark NC, McDougal LK, Flannagan SE, Kolonay JF, Shetty J, Killgore GE, Tenover FC. Genetic analysis of a high-level vancomycin-resistant isolate of Staphylococcus aureus. Science. 2003 Nov;302(5650):1569-71. DOI: 10.1126/science.1090956</RefTotal>
<RefLink>http://dx.doi.org/10.1126/science.1090956</RefLink>
</Reference>
<Reference refNo="10">
<RefAuthor>Buts L</RefAuthor>
<RefAuthor>Lah J</RefAuthor>
<RefAuthor>Dao-Thi MH</RefAuthor>
<RefAuthor>Wyns L</RefAuthor>
<RefAuthor>Loris R</RefAuthor>
<RefTitle>Toxin-antitoxin modules as bacterial metabolic stress managers</RefTitle>
<RefYear>2005</RefYear>
<RefJournal>Trends Biochem Sci</RefJournal>
<RefPage>672-9</RefPage>
<RefTotal>Buts L, Lah J, Dao-Thi MH, Wyns L, Loris R. Toxin-antitoxin modules as bacterial metabolic stress managers. Trends Biochem Sci. 2005 Dec;30(12):672-9. DOI: 10.1016/j.tibs.2005.10.004</RefTotal>
<RefLink>http://dx.doi.org/10.1016/j.tibs.2005.10.004</RefLink>
</Reference>
<Reference refNo="11">
<RefAuthor>Aizenman E</RefAuthor>
<RefAuthor>Engelberg-Kulka H</RefAuthor>
<RefAuthor>Glaser G</RefAuthor>
<RefTitle>An Escherichia coli chromosomal "addiction module" regulated by guanosine [corrected] 3',5'-bispyrophosphate: a model for programmed bacterial cell death</RefTitle>
<RefYear>1996</RefYear>
<RefJournal>Proc Natl Acad Sci USA</RefJournal>
<RefPage>6059-63</RefPage>
<RefTotal>Aizenman E, Engelberg-Kulka H, Glaser G. An Escherichia coli chromosomal "addiction module" regulated by guanosine [corrected] 3',5'-bispyrophosphate: a model for programmed bacterial cell death. Proc Natl Acad Sci USA. 1996 Jun;93(12):6059-63. DOI: 10.1073/pnas.93.12.6059</RefTotal>
<RefLink>http://dx.doi.org/10.1073/pnas.93.12.6059</RefLink>
</Reference>
<Reference refNo="12">
<RefAuthor>Hayes F</RefAuthor>
<RefTitle>Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest</RefTitle>
<RefYear>2003</RefYear>
<RefJournal>Science</RefJournal>
<RefPage>1496-9</RefPage>
<RefTotal>Hayes F. Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest. Science. 2003 Sep;301(5639):1496-9. DOI: 10.1126/science.1088157</RefTotal>
<RefLink>http://dx.doi.org/10.1126/science.1088157</RefLink>
</Reference>
<Reference refNo="13">
<RefAuthor>Engelberg-Kulka H</RefAuthor>
<RefAuthor>Sat B</RefAuthor>
<RefAuthor>Reches M</RefAuthor>
<RefAuthor>Amitai S</RefAuthor>
<RefAuthor>Hazan R</RefAuthor>
<RefTitle>Bacterial programmed cell death systems as targets for antibiotics</RefTitle>
<RefYear>2004</RefYear>
<RefJournal>Trends Microbiol</RefJournal>
<RefPage>66-71</RefPage>
<RefTotal>Engelberg-Kulka H, Sat B, Reches M, Amitai S, Hazan R. Bacterial programmed cell death systems as targets for antibiotics. Trends Microbiol. 2004 Feb;12(2):66-71. DOI: 10.1016/j.tim.2003.12.008</RefTotal>
<RefLink>http://dx.doi.org/10.1016/j.tim.2003.12.008</RefLink>
</Reference>
<Reference refNo="14">
<RefAuthor>Munoz-Gomez AJ</RefAuthor>
<RefAuthor>Santos-Sierra S</RefAuthor>
<RefAuthor>Berzal-Herranz A</RefAuthor>
<RefAuthor>Lemonnier M</RefAuthor>
<RefAuthor>Diaz-Orejas R</RefAuthor>
<RefTitle>Insights into the specificity of RNA cleavage by the Escherichia coli MazF toxin</RefTitle>
<RefYear>2004</RefYear>
<RefJournal>FEBS Lett</RefJournal>
<RefPage>316-20</RefPage>
<RefTotal>Munoz-Gomez AJ, Santos-Sierra S, Berzal-Herranz A, Lemonnier M, Diaz-Orejas R. Insights into the specificity of RNA cleavage by the Escherichia coli MazF toxin. FEBS Lett. 2004 Jun;567(2-3):316-20. DOI: 10.1016/j.febslet.2004.05.005</RefTotal>
<RefLink>http://dx.doi.org/10.1016/j.febslet.2004.05.005</RefLink>
</Reference>
<Reference refNo="15">
<RefAuthor>Engelberg-Kulka H</RefAuthor>
<RefAuthor>Hazan R</RefAuthor>
<RefAuthor>Amitai S</RefAuthor>
<RefTitle>mazEF: a chromosomal toxin-antitoxin module that triggers programmed cell death in bacteria</RefTitle>
<RefYear>2005</RefYear>
<RefJournal>J Cell Sci</RefJournal>
<RefPage>4327-32</RefPage>
<RefTotal>Engelberg-Kulka H, Hazan R, Amitai S. mazEF: a chromosomal toxin-antitoxin module that triggers programmed cell death in bacteria. J Cell Sci. 2005 Oct;118(Pt 19):4327-32. DOI: 10.1242/jcs.02619</RefTotal>
<RefLink>http://dx.doi.org/10.1242/jcs.02619</RefLink>
</Reference>
<Reference refNo="16">
<RefAuthor>Faridani OR</RefAuthor>
<RefAuthor>Nikravesh A</RefAuthor>
<RefAuthor>Pandey DP</RefAuthor>
<RefAuthor>Gerdes K</RefAuthor>
<RefAuthor>Good L</RefAuthor>
<RefTitle>Competitive inhibition of natural antisense Sok-RNA interactions activates Hok-mediated cell killing in Escherichia coli</RefTitle>
<RefYear>2006</RefYear>
<RefJournal>Nucleic Acids Res</RefJournal>
<RefPage>5915-22</RefPage>
<RefTotal>Faridani OR, Nikravesh A, Pandey DP, Gerdes K, Good L. Competitive inhibition of natural antisense Sok-RNA interactions activates Hok-mediated cell killing in Escherichia coli. Nucleic Acids Res. 2006;34(20):5915-22. DOI: 10.1093/nar/gkl750</RefTotal>
<RefLink>http://dx.doi.org/10.1093/nar/gkl750</RefLink>
</Reference>
</References>
<Media>
<Tables>
<Table format="png">
<MediaNo>1</MediaNo>
<MediaID>1</MediaID>
<Caption><Pgraph><Mark1>Table 1: Prevalence of VRE in Milad and Ilam Hospitals</Mark1></Pgraph></Caption>
</Table>
<NoOfTables>1</NoOfTables>
</Tables>
<Figures>
<Figure format="png" height="603" width="276">
<MediaNo>1</MediaNo>
<MediaID>1</MediaID>
<Caption><Pgraph><Mark1>Figure 1: PCR analysis of VRE clinical isolates; M (Marker 1 kb plus, Thermo Science), 1 = </Mark1><Mark1><Mark2>mazEF</Mark2></Mark1><Mark1>, 505 bp)</Mark1></Pgraph></Caption>
</Figure>
<NoOfPictures>1</NoOfPictures>
</Figures>
<InlineFigures>
<NoOfPictures>0</NoOfPictures>
</InlineFigures>
<Attachments>
<NoOfAttachments>0</NoOfAttachments>
</Attachments>
</Media>
</OrigData>
</GmsArticle>]]></plaintext></textgroup></pgraph></textblock></origdata></gmsarticle>